Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719634338:

Variant ID: vg0719634338 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19634338
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGATGAGATATTTCTTCTCCCGGCGGGGCTCACACCCGGTGGAGATAAGGTCGATTTTTCTCGACTTCTCGTCTCTCGCTCTCGAGGCGCCCTCCCCT[G/C]
CGCTAGATCCGACAGGGCCGGGAGGGGAGGCGCGGTGGCGGCTGACGGCATGAAGGGGAGGCGATGGTGGCCCGGCAGGGGCAGGAGGGGCGGAGACGCC

Reverse complement sequence

GGCGTCTCCGCCCCTCCTGCCCCTGCCGGGCCACCATCGCCTCCCCTTCATGCCGTCAGCCGCCACCGCGCCTCCCCTCCCGGCCCTGTCGGATCTAGCG[C/G]
AGGGGAGGGCGCCTCGAGAGCGAGAGACGAGAAGTCGAGAAAAATCGACCTTATCTCCACCGGGTGTGAGCCCCGCCGGGAGAAGAAATATCTCATCCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	22.90%	0.02%	0.00%	NA
All Indica	2759	96.30%	3.70%	0.00%	0.00%	NA
All Japonica	1512	36.10%	63.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.40%	6.60%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	4.10%	0.00%	0.00%	NA
Temperate Japonica	767	4.30%	95.70%	0.00%	0.00%	NA
Tropical Japonica	504	87.70%	12.30%	0.00%	0.00%	NA
Japonica Intermediate	241	29.50%	70.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719634338	G -> C	LOC_Os07g32810.1	upstream_gene_variant ; 2656.0bp to feature; MODIFIER	silent_mutation	Average:64.409; most accessible tissue: Zhenshan97 root, score: 77.733	N	N	N	N
vg0719634338	G -> C	LOC_Os07g32820.1	upstream_gene_variant ; 50.0bp to feature; MODIFIER	silent_mutation	Average:64.409; most accessible tissue: Zhenshan97 root, score: 77.733	N	N	N	N
vg0719634338	G -> C	LOC_Os07g32810-LOC_Os07g32820	intergenic_region ; MODIFIER	silent_mutation	Average:64.409; most accessible tissue: Zhenshan97 root, score: 77.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719634338	NA	5.77E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	4.75E-41	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	3.18E-32	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	1.41E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	9.24E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	6.48E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	4.01E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	5.18E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	3.16E-07	8.98E-22	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	2.19E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	8.22E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	1.35E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	4.57E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	3.26E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	6.86E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	1.06E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	1.95E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	4.89E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	3.49E-26	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	1.33E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719634338	NA	2.03E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251