Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719633026:

Variant ID: vg0719633026 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19633026
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCACTGTAGTCAGGTCACACTGTAGCTAACTAGGGGTGGATATATAATAAGCCATCTCGGTTTGACAAGCTTGCTTGCTTAGGCCCTCTTTGTTTAGA[C/T]
TTATAAGCCAACTTATAAGTCAAAAAGTCTAAACCAAAACAAACAAGCAGCTTTTTTATTTGGCTTTTTTAAGCCATAAGCCACTCTAACACTATTAAGG

Reverse complement sequence

CCTTAATAGTGTTAGAGTGGCTTATGGCTTAAAAAAGCCAAATAAAAAAGCTGCTTGTTTGTTTTGGTTTAGACTTTTTGACTTATAAGTTGGCTTATAA[G/A]
TCTAAACAAAGAGGGCCTAAGCAAGCAAGCTTGTCAAACCGAGATGGCTTATTATATATCCACCCCTAGTTAGCTACAGTGTGACCTGACTACAGTGAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	42.50%	6.09%	0.13%	NA
All Indica	2759	66.50%	23.80%	9.50%	0.22%	NA
All Japonica	1512	17.50%	81.70%	0.79%	0.00%	NA
Aus	269	82.20%	17.10%	0.74%	0.00%	NA
Indica I	595	63.70%	19.30%	16.81%	0.17%	NA
Indica II	465	68.00%	22.40%	9.46%	0.22%	NA
Indica III	913	70.20%	26.80%	2.96%	0.00%	NA
Indica Intermediate	786	63.40%	24.60%	11.58%	0.51%	NA
Temperate Japonica	767	3.00%	96.90%	0.13%	0.00%	NA
Tropical Japonica	504	39.30%	59.10%	1.59%	0.00%	NA
Japonica Intermediate	241	18.30%	80.50%	1.24%	0.00%	NA
VI/Aromatic	96	62.50%	35.40%	2.08%	0.00%	NA
Intermediate	90	46.70%	42.20%	11.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719633026	C -> DEL	N	N	silent_mutation	Average:43.466; most accessible tissue: Callus, score: 84.166	N	N	N	N
vg0719633026	C -> T	LOC_Os07g32800.1	upstream_gene_variant ; 4733.0bp to feature; MODIFIER	silent_mutation	Average:43.466; most accessible tissue: Callus, score: 84.166	N	N	N	N
vg0719633026	C -> T	LOC_Os07g32810.1	upstream_gene_variant ; 1344.0bp to feature; MODIFIER	silent_mutation	Average:43.466; most accessible tissue: Callus, score: 84.166	N	N	N	N
vg0719633026	C -> T	LOC_Os07g32820.1	upstream_gene_variant ; 1362.0bp to feature; MODIFIER	silent_mutation	Average:43.466; most accessible tissue: Callus, score: 84.166	N	N	N	N
vg0719633026	C -> T	LOC_Os07g32810-LOC_Os07g32820	intergenic_region ; MODIFIER	silent_mutation	Average:43.466; most accessible tissue: Callus, score: 84.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719633026	NA	4.07E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.29E-12	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.61E-37	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	3.29E-08	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	5.45E-13	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	8.65E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.95E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	8.08E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.31E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.49E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.13E-07	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.52E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.22E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.30E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.76E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	5.21E-08	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.79E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.20E-11	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.81E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.73E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.81E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	5.42E-06	mr1306_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	9.14E-07	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.67E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.23E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	6.98E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.29E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	5.11E-06	4.71E-08	mr1480_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.33E-37	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.42E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	9.48E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	6.10E-28	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.44E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.10E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.82E-13	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.58E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.46E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	4.52E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	7.05E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	1.04E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.90E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026	NA	2.08E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251