Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719613006:

Variant ID: vg0719613006 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19613006
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCGAACGTGGTGCCTCCTTTCAAGGATGTTTTAATAATATAATAGATAAGGAAAAACATAGTACAAAATAAGATAGTTGGACGAATACTAGACAAAA[G/T]
TAAATATATGATGAATAAAATAGTACAAAAGTTGACAGATAAAGAATAAACTAGTACAACAGTTATACCTGGAATTACAAATCTATTATATATGTGGACA

Reverse complement sequence

TGTCCACATATATAATAGATTTGTAATTCCAGGTATAACTGTTGTACTAGTTTATTCTTTATCTGTCAACTTTTGTACTATTTTATTCATCATATATTTA[C/A]
TTTTGTCTAGTATTCGTCCAACTATCTTATTTTGTACTATGTTTTTCCTTATCTATTATATTATTAAAACATCCTTGAAAGGAGGCACCACGTTCGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	13.50%	0.00%	0.00%	NA
All Indica	2759	77.90%	22.10%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	40.60%	59.40%	0.00%	0.00%	NA
Indica III	913	79.80%	20.20%	0.00%	0.00%	NA
Indica Intermediate	786	81.30%	18.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719613006	G -> T	LOC_Os07g32774.1	upstream_gene_variant ; 3961.0bp to feature; MODIFIER	silent_mutation	Average:29.959; most accessible tissue: Callus, score: 60.324	N	N	N	N
vg0719613006	G -> T	LOC_Os07g32790.1	downstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:29.959; most accessible tissue: Callus, score: 60.324	N	N	N	N
vg0719613006	G -> T	LOC_Os07g32774-LOC_Os07g32790	intergenic_region ; MODIFIER	silent_mutation	Average:29.959; most accessible tissue: Callus, score: 60.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719613006	NA	3.55E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	5.98E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	3.28E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	4.76E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	1.66E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	9.24E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	2.01E-07	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	6.51E-07	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	4.21E-08	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	9.77E-08	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	1.22E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	2.66E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	7.67E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	3.94E-06	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	3.41E-07	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	1.63E-07	mr1931_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	4.84E-09	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719613006	NA	8.17E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251