\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719559025:

Variant ID: vg0719559025 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19559025
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATCGGATGTTTGGACACTAATTTGAAGTATTAAACATATACTAATTACAAAACCCATTCCATAAGCTTGGACTAATTCGTGAGACGAATCTTTTGAG[C/T]
CTAATTACGCTATGATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATGGATTAATTAGGCTTAAAAAAATCGTCTCGCGGATTAGCTCTCAT

Reverse complement sequence

ATGAGAGCTAATCCGCGAGACGATTTTTTTAAGCCTAATTAATCCATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATCATAGCGTAATTAG[G/A]
CTCAAAAGATTCGTCTCACGAATTAGTCCAAGCTTATGGAATGGGTTTTGTAATTAGTATATGTTTAATACTTCAAATTAGTGTCCAAACATCCGATGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 19.60% 2.39% 22.49% NA
All Indica  2759 73.50% 0.70% 0.72% 25.08% NA
All Japonica  1512 19.40% 59.00% 4.83% 16.80% NA
Aus  269 90.30% 0.00% 0.00% 9.67% NA
Indica I  595 85.90% 0.30% 0.67% 13.11% NA
Indica II  465 83.70% 1.50% 0.65% 14.19% NA
Indica III  913 57.50% 0.10% 0.44% 41.95% NA
Indica Intermediate  786 76.60% 1.30% 1.15% 20.99% NA
Temperate Japonica  767 2.10% 93.00% 2.48% 2.48% NA
Tropical Japonica  504 52.60% 10.70% 2.38% 34.33% NA
Japonica Intermediate  241 5.00% 51.90% 17.43% 25.73% NA
VI/Aromatic  96 12.50% 0.00% 15.62% 71.88% NA
Intermediate  90 56.70% 13.30% 5.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719559025 C -> DEL N N silent_mutation Average:84.603; most accessible tissue: Minghui63 root, score: 88.381 N N N N
vg0719559025 C -> T LOC_Os07g32740.1 upstream_gene_variant ; 2019.0bp to feature; MODIFIER silent_mutation Average:84.603; most accessible tissue: Minghui63 root, score: 88.381 N N N N
vg0719559025 C -> T LOC_Os07g32730-LOC_Os07g32740 intergenic_region ; MODIFIER silent_mutation Average:84.603; most accessible tissue: Minghui63 root, score: 88.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719559025 C T 0.06 0.02 0.01 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719559025 NA 5.34E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 9.22E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 1.78E-57 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 1.43E-55 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 4.98E-60 mr1235_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 3.92E-59 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 1.76E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 3.78E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 9.64E-40 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 1.94E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 9.99E-97 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 4.79E-53 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 7.08E-31 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 7.72E-40 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 9.36E-62 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 8.09E-47 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 9.76E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 4.03E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 5.95E-45 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719559025 NA 1.77E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251