Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719533358:

Variant ID: vg0719533358 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19533358
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TCGACGACGACGGGTTCGGGCCCGGTGGGTTCGGCCATGGCCCCAAGGGGTTCGGACGCGGCCCTGGCTTTGGCCATGACTGCCGCTTCGGCCGGTGCCG[C/T]
GGCGGCGGTGGAGGATTTGGAGGAGATGGAGGCTTCGGAGGCGGAGGCGGTGGTGGGCTTGGTGGAGGTGGCGGGTTTGGAGGCGGAGGTGGCGCTGGAG

Reverse complement sequence

CTCCAGCGCCACCTCCGCCTCCAAACCCGCCACCTCCACCAAGCCCACCACCGCCTCCGCCTCCGAAGCCTCCATCTCCTCCAAATCCTCCACCGCCGCC[G/A]
CGGCACCGGCCGAAGCGGCAGTCATGGCCAAAGCCAGGGCCGCGTCCGAACCCCTTGGGGCCATGGCCGAACCCACCGGGCCCGAACCCGTCGTCGTCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.30% 0.04% 0.00% NA
All Indica  2759 81.40% 18.60% 0.04% 0.00% NA
All Japonica  1512 32.90% 67.10% 0.00% 0.00% NA
Aus  269 8.90% 91.10% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 69.00% 31.00% 0.00% 0.00% NA
Indica III  913 82.00% 18.00% 0.00% 0.00% NA
Indica Intermediate  786 79.80% 20.10% 0.13% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 70.20% 29.80% 0.00% 0.00% NA
Japonica Intermediate  241 46.10% 53.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719533358 C -> T LOC_Os07g32710.1 synonymous_variant ; p.Arg61Arg; LOW synonymous_codon Average:79.448; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719533358 C T 0.0 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719533358 5.94E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 9.36E-10 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 2.48E-08 NA mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.06E-06 2.30E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 8.48E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 6.77E-08 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 6.66E-09 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.67E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.38E-07 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 2.39E-10 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 5.32E-06 NA mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.69E-07 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 7.59E-06 6.41E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.74E-06 6.39E-14 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 2.06E-07 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 3.80E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 1.06E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 5.76E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.68E-06 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 2.06E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 5.73E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 5.16E-08 NA mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 1.70E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 7.05E-13 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 8.81E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 5.61E-06 1.75E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 5.06E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 2.77E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.07E-10 NA mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.49E-06 NA mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 6.43E-07 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.09E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 2.12E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 8.95E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 4.45E-06 NA mr1200_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 6.44E-11 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 1.50E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.06E-08 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 3.10E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.56E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 1.29E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 2.26E-09 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 3.32E-09 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.41E-08 NA mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 3.73E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 1.39E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 1.04E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 8.31E-10 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 NA 8.54E-07 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 4.05E-06 NA mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719533358 3.10E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251