\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719527870:

Variant ID: vg0719527870 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19527870
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTAATGATGGTGATATGATATGATATTATGATCCGTCGTCTTCAACCCTAGCTAGCTAGTCGATCAAGATATCCCATCAATGCATTGCATTGTAGTG[C/A,T]
TAGGCTGTGTTTAGTTCACACGAAAATTAAAAGTTTGGTTGAAATTAGAACGATGTGACGGAAAAGTTGAAAGTTTATGTGTGTAGAAAAGTTTTGATGT

Reverse complement sequence

ACATCAAAACTTTTCTACACACATAAACTTTCAACTTTTCCGTCACATCGTTCTAATTTCAACCAAACTTTTAATTTTCGTGTGAACTAAACACAGCCTA[G/T,A]
CACTACAATGCAATGCATTGATGGGATATCTTGATCGACTAGCTAGCTAGGGTTGAAGACGACGGATCATAATATCATATCATATCACCATCATTAATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.70% 0.02% 0.00% T: 0.13%
All Indica  2759 84.00% 15.80% 0.00% 0.00% T: 0.14%
All Japonica  1512 79.60% 20.40% 0.00% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 97.20% 1.90% 0.00% 0.00% T: 0.86%
Indica III  913 76.00% 24.00% 0.00% 0.00% NA
Indica Intermediate  786 80.20% 19.80% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 63.30% 36.70% 0.00% 0.00% NA
Japonica Intermediate  241 57.70% 42.30% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 72.20% 25.60% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719527870 C -> A LOC_Os07g32700.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N
vg0719527870 C -> A LOC_Os07g32690.1 downstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N
vg0719527870 C -> A LOC_Os07g32690-LOC_Os07g32700 intergenic_region ; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N
vg0719527870 C -> T LOC_Os07g32700.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N
vg0719527870 C -> T LOC_Os07g32690.1 downstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N
vg0719527870 C -> T LOC_Os07g32690-LOC_Os07g32700 intergenic_region ; MODIFIER silent_mutation Average:78.352; most accessible tissue: Minghui63 young leaf, score: 92.097 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719527870 C A -0.05 0.04 0.01 -0.13 -0.07 -0.06
vg0719527870 C T -0.07 -0.05 -0.04 -0.09 -0.08 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719527870 3.17E-06 3.17E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 4.16E-06 3.03E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 1.24E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 5.20E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 9.77E-11 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 2.11E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 6.36E-07 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 7.17E-09 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 6.26E-06 mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 6.19E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 5.11E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 2.93E-06 NA mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.43E-07 NA mr1085_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 5.75E-07 1.48E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.39E-06 NA mr1088_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.54E-07 5.71E-09 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 6.39E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.12E-06 1.36E-07 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.65E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 4.21E-06 9.51E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 3.82E-07 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 6.09E-07 2.83E-09 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.13E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 5.31E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 4.50E-06 4.51E-06 mr1233_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 6.01E-07 3.88E-10 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 3.15E-06 1.39E-09 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 NA 2.19E-07 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 1.84E-06 NA mr1620_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719527870 4.29E-07 4.66E-09 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251