\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719520013:

Variant ID: vg0719520013 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19520013
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGTCTAGGATGGCCAATGGTGGGCCATCGACATGGCGAAGCCACGTGCTACCAGAGGTTGTTAGGTTGGCAGAGCTTTGGAGTGAGACAGCATATGTG[G/A]
GAGAGGTTGCTACAGGCAAAATACTAACTCAAGAAGTACCAGCTGGAGTTAGGGTCTGGGCGGCACCCAGGCGACTGGGTTGCGGCAGCCTTCTCCTCCC

Reverse complement sequence

GGGAGGAGAAGGCTGCCGCAACCCAGTCGCCTGGGTGCCGCCCAGACCCTAACTCCAGCTGGTACTTCTTGAGTTAGTATTTTGCCTGTAGCAACCTCTC[C/T]
CACATATGCTGTCTCACTCCAAAGCTCTGCCAACCTAACAACCTCTGGTAGCACGTGGCTTCGCCATGTCGATGGCCCACCATTGGCCATCCTAGACCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 8.40% 5.12% 7.15% NA
All Indica  2759 84.20% 6.30% 4.78% 4.75% NA
All Japonica  1512 73.60% 10.80% 5.56% 10.05% NA
Aus  269 87.70% 6.70% 1.12% 4.46% NA
Indica I  595 91.10% 1.80% 5.88% 1.18% NA
Indica II  465 98.10% 0.90% 0.43% 0.65% NA
Indica III  913 76.10% 11.80% 3.72% 8.32% NA
Indica Intermediate  786 80.20% 6.40% 7.76% 5.73% NA
Temperate Japonica  767 97.30% 0.70% 1.17% 0.91% NA
Tropical Japonica  504 45.80% 21.80% 10.32% 22.02% NA
Japonica Intermediate  241 56.40% 19.90% 9.54% 14.11% NA
VI/Aromatic  96 13.50% 39.60% 15.62% 31.25% NA
Intermediate  90 71.10% 5.60% 8.89% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719520013 G -> DEL N N silent_mutation Average:45.239; most accessible tissue: Callus, score: 62.476 N N N N
vg0719520013 G -> A LOC_Os07g32680.1 downstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:45.239; most accessible tissue: Callus, score: 62.476 N N N N
vg0719520013 G -> A LOC_Os07g32690.1 intron_variant ; MODIFIER silent_mutation Average:45.239; most accessible tissue: Callus, score: 62.476 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719520013 NA 5.08E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 1.05E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 6.69E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 1.24E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 1.69E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 8.08E-08 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 3.87E-06 NA mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 NA 1.32E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719520013 5.05E-06 3.82E-07 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251