\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719512715:

Variant ID: vg0719512715 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19512715
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAATGAATATAGTCTGTTATGGATTACTTAAAAACAAATAAAGGGAGTAGTTAGTAAGAATATTTGGATGAGCAAGACGTAAAGGATTAATATGTTTC[C/T]
ATGTGATAATTTTTAATTAAAGTATAGTTAACGTGGGATGTACTCGTAATATTTTTCTCTTGCGTAATAGATCTAATTTGGATCTTCTTACTTTTTTGTT

Reverse complement sequence

AACAAAAAAGTAAGAAGATCCAAATTAGATCTATTACGCAAGAGAAAAATATTACGAGTACATCCCACGTTAACTATACTTTAATTAAAAATTATCACAT[G/A]
GAAACATATTAATCCTTTACGTCTTGCTCATCCAAATATTCTTACTAACTACTCCCTTTATTTGTTTTTAAGTAATCCATAACAGACTATATTCATTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.20% 0.87% 0.00% NA
All Indica  2759 87.00% 11.50% 1.49% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 76.60% 23.40% 0.00% 0.00% NA
Indica I  595 92.80% 6.60% 0.67% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 78.00% 18.50% 3.50% 0.00% NA
Indica Intermediate  786 85.80% 13.60% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719512715 C -> T LOC_Os07g32680.1 upstream_gene_variant ; 2175.0bp to feature; MODIFIER silent_mutation Average:42.248; most accessible tissue: Callus, score: 64.415 N N N N
vg0719512715 C -> T LOC_Os07g32670-LOC_Os07g32680 intergenic_region ; MODIFIER silent_mutation Average:42.248; most accessible tissue: Callus, score: 64.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719512715 8.85E-06 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 1.64E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 1.53E-06 NA mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 NA 6.79E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 8.04E-06 NA mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 9.28E-06 NA mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719512715 6.76E-06 6.74E-06 mr1953_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251