\
| Variant ID: vg0719512715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19512715 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 186. )
GTAAATGAATATAGTCTGTTATGGATTACTTAAAAACAAATAAAGGGAGTAGTTAGTAAGAATATTTGGATGAGCAAGACGTAAAGGATTAATATGTTTC[C/T]
ATGTGATAATTTTTAATTAAAGTATAGTTAACGTGGGATGTACTCGTAATATTTTTCTCTTGCGTAATAGATCTAATTTGGATCTTCTTACTTTTTTGTT
AACAAAAAAGTAAGAAGATCCAAATTAGATCTATTACGCAAGAGAAAAATATTACGAGTACATCCCACGTTAACTATACTTTAATTAAAAATTATCACAT[G/A]
GAAACATATTAATCCTTTACGTCTTGCTCATCCAAATATTCTTACTAACTACTCCCTTTATTTGTTTTTAAGTAATCCATAACAGACTATATTCATTTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.20% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 11.50% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 6.60% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.00% | 18.50% | 3.50% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 13.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719512715 | C -> T | LOC_Os07g32680.1 | upstream_gene_variant ; 2175.0bp to feature; MODIFIER | silent_mutation | Average:42.248; most accessible tissue: Callus, score: 64.415 | N | N | N | N |
| vg0719512715 | C -> T | LOC_Os07g32670-LOC_Os07g32680 | intergenic_region ; MODIFIER | silent_mutation | Average:42.248; most accessible tissue: Callus, score: 64.415 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719512715 | 8.85E-06 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | 1.64E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | 1.53E-06 | NA | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | NA | 6.79E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | 8.04E-06 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | 9.28E-06 | NA | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719512715 | 6.76E-06 | 6.74E-06 | mr1953_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |