Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719505903:

Variant ID: vg0719505903 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19505903
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAATTTACTGATTATAATTTTGTTGCAATAAATCTTATATGATATGAGAAATTATAAGTCAAAAATTAGTTTTGAAGACTGTGCCAAGTTTGACCATG[C/T,A]
CTTATATTATAGAATGGAAGGAGTACTTAATTAATCACGTGCTAATAGATCGTTCCGTTTTCCGTGCGGAGGGAATGAGTTCCCAGAAACGAAAGCAACG

Reverse complement sequence

CGTTGCTTTCGTTTCTGGGAACTCATTCCCTCCGCACGGAAAACGGAACGATCTATTAGCACGTGATTAATTAAGTACTCCTTCCATTCTATAATATAAG[G/A,T]
CATGGTCAAACTTGGCACAGTCTTCAAAACTAATTTTTGACTTATAATTTCTCATATCATATAAGATTTATTGCAACAAAATTATAATCAGTAAATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	43.30%	0.13%	0.00%	A: 0.02%
All Indica	2759	29.90%	69.90%	0.14%	0.00%	NA
All Japonica	1512	99.10%	0.80%	0.07%	0.00%	NA
Aus	269	73.60%	26.40%	0.00%	0.00%	NA
Indica I	595	10.40%	89.20%	0.34%	0.00%	NA
Indica II	465	38.90%	60.90%	0.22%	0.00%	NA
Indica III	913	37.20%	62.70%	0.11%	0.00%	NA
Indica Intermediate	786	30.90%	69.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.20%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	1.11%	0.00%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719505903	C -> A	LOC_Os07g32670.1	downstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0719505903	C -> A	LOC_Os07g32670-LOC_Os07g32680	intergenic_region ; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0719505903	C -> T	LOC_Os07g32670.1	downstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0719505903	C -> T	LOC_Os07g32670-LOC_Os07g32680	intergenic_region ; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719505903	8.52E-06	4.97E-09	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	5.26E-06	2.54E-09	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	2.76E-06	2.74E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	1.48E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	6.54E-06	3.07E-09	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	8.09E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	5.14E-11	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	1.73E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	2.50E-13	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	4.78E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	1.16E-08	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	1.11E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	6.20E-10	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	6.15E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	6.84E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	3.48E-07	NA	mr1067_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	8.71E-06	NA	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	2.87E-06	1.37E-07	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	5.24E-07	NA	mr1103_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	4.96E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	2.74E-11	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	8.40E-08	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719505903	NA	4.60E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251