\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719457334:

Variant ID: vg0719457334 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19457334
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAATTCCGGAGTTTCCAAAATATGTGGGTTTTTTATTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTAAAACATTGTAAGTA[C/A,T]
ACTAGATGAAACATCTTTTGTGGAAAAAGGGGATAGAGAAGTGGGTGGGCCCAGCAGGTGCGCACGTGGGGGGAGGGGCGCGCGGGGGGAGCACCCGATC

Reverse complement sequence

GATCGGGTGCTCCCCCCGCGCGCCCCTCCCCCCACGTGCGCACCTGCTGGGCCCACCCACTTCTCTATCCCCTTTTTCCACAAAAGATGTTTCATCTAGT[G/T,A]
TACTTACAATGTTTTACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAATAAAAAACCCACATATTTTGGAAACTCCGGAATTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.70% 0.15% 0.00% T: 0.02%
All Indica  2759 96.80% 3.10% 0.07% 0.00% NA
All Japonica  1512 35.30% 64.40% 0.20% 0.00% T: 0.07%
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 97.90% 2.00% 0.11% 0.00% NA
Indica Intermediate  786 94.10% 5.70% 0.13% 0.00% NA
Temperate Japonica  767 4.30% 95.30% 0.26% 0.00% T: 0.13%
Tropical Japonica  504 79.20% 20.80% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719457334 C -> A LOC_Os07g32620.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0719457334 C -> A LOC_Os07g32630.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0719457334 C -> A LOC_Os07g32620-LOC_Os07g32630 intergenic_region ; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0719457334 C -> T LOC_Os07g32620.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0719457334 C -> T LOC_Os07g32630.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0719457334 C -> T LOC_Os07g32620-LOC_Os07g32630 intergenic_region ; MODIFIER silent_mutation Average:57.257; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719457334 C A -0.01 -0.02 -0.01 -0.03 -0.01 -0.01
vg0719457334 C T -0.02 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719457334 NA 1.69E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 8.28E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 2.49E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 8.27E-06 NA mr1218 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 7.15E-07 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 2.28E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 1.66E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 2.48E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 1.02E-06 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 8.45E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 8.52E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 1.35E-37 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 8.87E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 9.60E-09 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 2.50E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 1.37E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 6.95E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719457334 NA 8.30E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251