\
| Variant ID: vg0719447778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19447778 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 81. )
TATTGAAGTGGTTTACTATTAATCTAGTCTATTGTTGAGGTGTACATGTTTTATAGATAGCACCTTACTTTACCATTGCGGGTGCTCTAATTCTGCATTT[C/G]
TGCTGCTCCGGCGGCCAGAGCGTGGAGAGATAATAACGTCTTCAGTCCGTTGGTGCCAATGCACACGCCTAGGACTTGATTAGTGTTTGCAGATCGTATA
TATACGATCTGCAAACACTAATCAAGTCCTAGGCGTGTGCATTGGCACCAACGGACTGAAGACGTTATTATCTCTCCACGCTCTGGCCGCCGGAGCAGCA[G/C]
AAATGCAGAATTAGAGCACCCGCAATGGTAAAGTAAGGTGCTATCTATAAAACATGTACACCTCAACAATAGACTAGATTAATAGTAAACCACTTCAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.80% | 38.20% | 13.84% | 1.16% | NA |
| All Indica | 2759 | 56.00% | 18.90% | 23.20% | 1.92% | NA |
| All Japonica | 1512 | 35.10% | 64.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 38.70% | 25.00% | 33.61% | 2.69% | NA |
| Indica II | 465 | 50.50% | 19.40% | 27.96% | 2.15% | NA |
| Indica III | 913 | 70.90% | 13.60% | 13.69% | 1.86% | NA |
| Indica Intermediate | 786 | 55.00% | 20.20% | 23.54% | 1.27% | NA |
| Temperate Japonica | 767 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.00% | 20.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 30.00% | 14.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719447778 | C -> DEL | N | N | silent_mutation | Average:37.832; most accessible tissue: Callus, score: 86.738 | N | N | N | N |
| vg0719447778 | C -> G | LOC_Os07g32610.2 | upstream_gene_variant ; 1834.0bp to feature; MODIFIER | silent_mutation | Average:37.832; most accessible tissue: Callus, score: 86.738 | N | N | N | N |
| vg0719447778 | C -> G | LOC_Os07g32610.1 | upstream_gene_variant ; 2149.0bp to feature; MODIFIER | silent_mutation | Average:37.832; most accessible tissue: Callus, score: 86.738 | N | N | N | N |
| vg0719447778 | C -> G | LOC_Os07g32610-LOC_Os07g32620 | intergenic_region ; MODIFIER | silent_mutation | Average:37.832; most accessible tissue: Callus, score: 86.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719447778 | NA | 1.86E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 1.39E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 3.44E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 7.84E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 3.66E-08 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 9.16E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 9.34E-07 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 7.61E-06 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 2.79E-14 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | 3.39E-06 | NA | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 5.30E-08 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 3.36E-09 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | 5.88E-06 | 2.01E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | 2.75E-06 | NA | mr1257_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 7.14E-09 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 1.73E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 2.76E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | 9.66E-06 | 3.28E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 4.69E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719447778 | NA | 2.06E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |