\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719389690:

Variant ID: vg0719389690 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19389690
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGTAATTATGATTTATTTTATTGTGACTTCATTTATCATCAAATGTTCTTTAAGCATGACATAAATACTTTTGTATTTGCACAAAAATTTTGAATAA[G/A]
ATGAATGGTCAAAAGTTGGTCAAGAAGTCAACAACGTCATACATTGAAACATGAAGGGAGTAGTATCTTTATAAAATGTACCCCACACTGGCTCCGGTGA

Reverse complement sequence

TCACCGGAGCCAGTGTGGGGTACATTTTATAAAGATACTACTCCCTTCATGTTTCAATGTATGACGTTGTTGACTTCTTGACCAACTTTTGACCATTCAT[C/T]
TTATTCAAAATTTTTGTGCAAATACAAAAGTATTTATGTCATGCTTAAAGAACATTTGATGATAAATGAAGTCACAATAAAATAAATCATAATTACATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 20.80% 0.02% 0.49% NA
All Indica  2759 77.50% 22.50% 0.00% 0.04% NA
All Japonica  1512 97.40% 1.10% 0.07% 1.46% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 84.20% 15.80% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 70.10% 29.90% 0.00% 0.00% NA
Indica Intermediate  786 70.50% 29.40% 0.00% 0.13% NA
Temperate Japonica  767 97.70% 1.20% 0.00% 1.17% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 96.30% 2.90% 0.41% 0.41% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719389690 G -> DEL N N silent_mutation Average:33.774; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0719389690 G -> A LOC_Os07g32530.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:33.774; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0719389690 G -> A LOC_Os07g32540.1 downstream_gene_variant ; 3686.0bp to feature; MODIFIER silent_mutation Average:33.774; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0719389690 G -> A LOC_Os07g32530-LOC_Os07g32540 intergenic_region ; MODIFIER silent_mutation Average:33.774; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719389690 NA 4.14E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719389690 NA 2.42E-10 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 2.82E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 1.18E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 1.84E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 2.84E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 3.13E-07 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 1.42E-06 1.93E-16 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 5.88E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 3.05E-08 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 2.97E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 3.86E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 5.60E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 3.53E-06 1.79E-09 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 1.32E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 9.95E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 2.52E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 7.43E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 8.07E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 3.73E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 4.36E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 6.85E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 7.46E-08 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 1.14E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 6.50E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 2.56E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 3.32E-10 mr1522_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719389690 NA 8.47E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251