\
| Variant ID: vg0719317820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19317820 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACCTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCACTAGGCGGTTTCCTATTGCTCGATCCAGTGACGGTAGTGCGGAGGAGGAGG[G/A]
AGGAAGGGGTGGTAGAGGCTACGTTTTGGGTCGCCACCTAAATCTCTTGCGCGGGGTGCACAAGGTTCTAGAGATCCTATAATCCACCACTCAACCTAAT
ATTAGGTTGAGTGGTGGATTATAGGATCTCTAGAACCTTGTGCACCCCGCGCAAGAGATTTAGGTGGCGACCCAAAACGTAGCCTCTACCACCCCTTCCT[C/T]
CCTCCTCCTCCGCACTACCGTCACTGGATCGAGCAATAGGAAACCGCCTAGTGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.40% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 82.20% | 17.30% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 70.90% | 29.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.90% | 29.80% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.20% | 32.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719317820 | G -> A | LOC_Os07g32460.1 | upstream_gene_variant ; 2342.0bp to feature; MODIFIER | silent_mutation | Average:25.165; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0719317820 | G -> A | LOC_Os07g32460-LOC_Os07g32470 | intergenic_region ; MODIFIER | silent_mutation | Average:25.165; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719317820 | 3.98E-06 | 7.23E-14 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.00E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 4.94E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 9.51E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 6.99E-08 | 1.93E-16 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 5.27E-09 | 1.50E-17 | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.24E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 2.81E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 9.97E-10 | 2.85E-18 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 2.41E-08 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 3.92E-08 | 1.11E-21 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 2.98E-10 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 4.02E-08 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.94E-08 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 4.53E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.18E-07 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 8.21E-07 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.54E-10 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.22E-08 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.99E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.08E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.75E-10 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.52E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.92E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.50E-06 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 1.02E-06 | 3.08E-11 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.98E-06 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 7.30E-17 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 2.27E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 7.55E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 4.11E-08 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 5.53E-08 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 9.32E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 9.10E-07 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 8.23E-09 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.90E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 7.61E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.45E-07 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | 3.66E-06 | 4.40E-10 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.08E-07 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 3.40E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719317820 | NA | 1.13E-08 | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |