\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719227901:

Variant ID: vg0719227901 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 19227901
Reference Allele: GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAAAlternative Allele: TCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA,G
Primary Allele: TCTCCAGTTCAATAAAAAGT ACCTCATGGTACTAASecondary Allele: GCTCCAGTTCAATAAAAAGT ACCTCATGGTACTAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCCGAATGCAGAAGGCTGCAGGTAATGCCATTTCCTCTTTTTTCCCCCAACAGCTCTGCATTTTGGACAGTTCCCGTTCTTTTCTGATCAGAAATTC[GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA/TCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA,G]
ATCGTTTTCGATCGTTGGATCTAACAATGTCCACCCTACCTAGCTAGATTTAACGATCGAAAATGATTTAGTACCGCGAGGAACCATGCACCAGGACCGA

Reverse complement sequence

TCGGTCCTGGTGCATGGTTCCTCGCGGTACTAAATCATTTTCGATCGTTAAATCTAGCTAGGTAGGGTGGACATTGTTAGATCCAACGATCGAAAACGAT[TTAGTACCATGAGGTACTTTTTATTGAACTGGAGC/TTAGTACCATGAGGTACTTTTTATTGAACTGGAGA,C]
GAATTTCTGATCAGAAAAGAACGGGAACTGTCCAAAATGCAGAGCTGTTGGGGGAAAAAAGAGGAAATGGCATTACCTGCAGCCTTCTGCATTCGGCTTC

Allele Frequencies:

Populations Population SizeFrequency of TCTCCAGTTCAATAAAAAGT ACCTCATGGTACTAA(primary allele) Frequency of GCTCCAGTTCAATAAAAAGT ACCTCATGGTACTAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.40% 0.02% 0.11% G: 0.04%
All Indica  2759 94.10% 5.80% 0.00% 0.14% NA
All Japonica  1512 30.60% 69.40% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 92.90% 6.70% 0.00% 0.43% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 10.80% 0.00% 0.25% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 69.00% 30.80% 0.00% 0.20% NA
Japonica Intermediate  241 36.50% 63.50% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 1.11% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> DEL N N silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> G LOC_Os07g32350.1 downstream_gene_variant ; 3746.0bp to feature; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> G LOC_Os07g32350.2 downstream_gene_variant ; 3746.0bp to feature; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> G LOC_Os07g32340.1 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> G LOC_Os07g32340.2 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> G LOC_Os07g32340.3 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> TCTCCAGTTCAATAAAAAGTACCTCATGGT ACTAA LOC_Os07g32350.1 downstream_gene_variant ; 3747.0bp to feature; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> TCTCCAGTTCAATAAAAAGTACCTCATGGT ACTAA LOC_Os07g32350.2 downstream_gene_variant ; 3747.0bp to feature; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> TCTCCAGTTCAATAAAAAGTACCTCATGGT ACTAA LOC_Os07g32340.1 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> TCTCCAGTTCAATAAAAAGTACCTCATGGT ACTAA LOC_Os07g32340.2 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0719227901 GCTCCAGTTCAATAAAAAGTACCTCATGGTACTAA -> TCTCCAGTTCAATAAAAAGTACCTCATGGT ACTAA LOC_Os07g32340.3 intron_variant ; MODIFIER silent_mutation Average:72.696; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719227901 4.10E-08 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.26E-11 7.29E-32 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.70E-06 7.58E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.27E-11 NA mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 8.75E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 8.95E-06 1.07E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.40E-10 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 6.37E-09 7.15E-34 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 1.63E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 9.50E-12 7.33E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 5.52E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.04E-08 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 5.07E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 6.10E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.32E-06 3.78E-07 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.29E-17 1.10E-48 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.22E-08 2.67E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.58E-08 8.35E-14 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.16E-11 NA mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 3.42E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.29E-07 2.63E-10 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 6.46E-09 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 2.04E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 2.91E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.24E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 5.44E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.62E-10 6.14E-16 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.31E-11 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 2.91E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.66E-08 6.62E-10 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 6.77E-07 NA mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 8.56E-12 2.53E-38 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 2.71E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.63E-07 1.51E-11 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 9.88E-09 NA mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 8.55E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 2.31E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.27E-12 4.88E-41 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 8.91E-08 7.20E-11 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 3.35E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 5.81E-07 mr1768 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 8.60E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 8.88E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.62E-07 NA mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 7.82E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.24E-07 3.31E-14 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 3.29E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 5.31E-09 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.83E-07 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.15E-14 NA mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.06E-06 4.14E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.16E-07 9.37E-09 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.51E-11 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.34E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.63E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.27E-06 NA mr1104_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.77E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 5.14E-07 NA mr1107_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.26E-06 1.08E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.20E-07 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 7.29E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 7.21E-06 NA mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 1.17E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 NA 3.85E-14 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.12E-15 6.47E-43 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.82E-07 4.19E-07 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.00E-08 3.91E-11 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.73E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 8.77E-06 NA mr1226_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 5.27E-12 2.44E-28 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.75E-06 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.96E-13 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.24E-06 1.60E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.11E-07 1.49E-11 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 5.07E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.34E-19 1.73E-65 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.82E-08 2.95E-09 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 7.41E-10 2.50E-13 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 7.53E-11 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 8.46E-16 1.91E-55 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.70E-07 1.30E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 4.06E-07 1.32E-08 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.33E-06 7.03E-08 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 2.57E-07 NA mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 1.40E-11 4.36E-25 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719227901 3.81E-06 NA mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251