\
| Variant ID: vg0719140779 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 19140779 |
| Reference Allele: A | Alternative Allele: G,ATG,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCATGAGGACCGTCTCAGGTGGGTTGCTTTAAAGGTTATGGGCAATGCTTGGAAGAACTTCAAGACTAAGCTAGTCGGCGAGTTCGTCTACAACCCGGC[A/G,ATG,C]
AATCCAGATTCAAGAGAGAAATTTCCTTGGATCACGGAACAGGTCTGGGAGGAATTCCATGCGAAAAAGTCAACCCCCGAGTCCAGAGCTAGAAGCGAGG
CCTCGCTTCTAGCTCTGGACTCGGGGGTTGACTTTTTCGCATGGAATTCCTCCCAGACCTGTTCCGTGATCCAAGGAAATTTCTCTCTTGAATCTGGATT[T/C,CAT,G]
GCCGGGTTGTAGACGAACTCGCCGACTAGCTTAGTCTTGAAGTTCTTCCAAGCATTGCCCATAACCTTTAAAGCAACCCACCTGAGACGGTCCTCATGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.10% | 19.00% | 41.22% | 8.57% | ATG: 4.99%; C: 0.17% |
| All Indica | 2759 | 3.30% | 8.00% | 66.04% | 14.35% | ATG: 8.37% |
| All Japonica | 1512 | 53.90% | 42.00% | 3.37% | 0.20% | C: 0.53% |
| Aus | 269 | 77.30% | 3.70% | 17.10% | 0.37% | ATG: 1.49% |
| Indica I | 595 | 0.80% | 3.20% | 70.76% | 20.00% | ATG: 5.21% |
| Indica II | 465 | 3.40% | 8.00% | 65.59% | 12.90% | ATG: 10.11% |
| Indica III | 913 | 2.80% | 6.10% | 68.13% | 11.61% | ATG: 11.28% |
| Indica Intermediate | 786 | 5.50% | 13.70% | 60.31% | 14.12% | ATG: 6.36% |
| Temperate Japonica | 767 | 38.90% | 55.30% | 5.61% | 0.26% | NA |
| Tropical Japonica | 504 | 78.60% | 18.80% | 0.79% | 0.20% | C: 1.59% |
| Japonica Intermediate | 241 | 50.20% | 48.10% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 21.10% | 32.22% | 5.56% | ATG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719140779 | A -> DEL | LOC_Os07g32220.1 | N | frameshift_variant | Average:28.722; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0719140779 | A -> G | LOC_Os07g32220.1 | synonymous_variant ; p.Ala122Ala; LOW | synonymous_codon | Average:28.722; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0719140779 | A -> G | LOC_Os07g32220.1 | synonymous_variant ; p.Ala122Ala; LOW | nonsynonymous_codon ; A122T | Average:28.722; most accessible tissue: Minghui63 root, score: 43.505 | benign |
0.411 |
TOLERATED | 0.10 |
| vg0719140779 | A -> ATG | LOC_Os07g32220.1 | frameshift_variant&stop_gained ; p.Asn123fs; HIGH | frameshift_variant | Average:28.722; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0719140779 | A -> C | LOC_Os07g32220.1 | synonymous_variant ; p.Ala122Ala; LOW | synonymous_codon | Average:28.722; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719140779 | 1.12E-08 | NA | mr1088 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 3.70E-06 | NA | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 5.12E-08 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | NA | 2.95E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 7.57E-08 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | NA | 2.70E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | NA | 8.22E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 9.91E-07 | NA | mr1620 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 4.08E-06 | NA | mr1735 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 1.52E-06 | NA | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 1.19E-06 | NA | mr1246_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719140779 | 2.21E-06 | NA | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |