Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719139937:

Variant ID: vg0719139937 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19139937
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCACCGACCGGCGACGCCCTCCACCGAGCCCGGTGCCGCCACCACCGAGCCCAACCGGCCATCCTCAGGTGAGTCCTCCATCGCACCGCCCTCTACTAAC[T/C]
GTGAATGACATGTCATTGAAATGTGGATGTGGATGATATGTGATTGAACTGGGAGTGAGACATGTCGATGTTGGGATGAAATGTGGTGCATTTATGAATT

Reverse complement sequence

AATTCATAAATGCACCACATTTCATCCCAACATCGACATGTCTCACTCCCAGTTCAATCACATATCATCCACATCCACATTTCAATGACATGTCATTCAC[A/G]
GTTAGTAGAGGGCGGTGCGATGGAGGACTCACCTGAGGATGGCCGGTTGGGCTCGGTGGTGGCGGCACCGGGCTCGGTGGAGGGCGTCGCCGGTCGGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	11.10%	13.63%	17.37%	NA
All Indica	2759	46.60%	1.50%	22.65%	29.18%	NA
All Japonica	1512	87.10%	12.60%	0.13%	0.20%	NA
Aus	269	19.70%	77.30%	2.60%	0.37%	NA
Indica I	595	37.10%	0.20%	34.96%	27.73%	NA
Indica II	465	28.00%	2.60%	23.66%	45.81%	NA
Indica III	913	61.00%	0.90%	14.46%	23.66%	NA
Indica Intermediate	786	48.20%	2.70%	22.26%	26.84%	NA
Temperate Japonica	767	99.50%	0.10%	0.13%	0.26%	NA
Tropical Japonica	504	64.90%	34.90%	0.00%	0.20%	NA
Japonica Intermediate	241	94.20%	5.40%	0.41%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	8.90%	11.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719139937	T -> DEL	N	N	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0719139937	T -> C	LOC_Os07g32210.1	upstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0719139937	T -> C	LOC_Os07g32220.1	upstream_gene_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0719139937	T -> C	LOC_Os07g32190.1	downstream_gene_variant ; 3163.0bp to feature; MODIFIER	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0719139937	T -> C	LOC_Os07g32200.1	downstream_gene_variant ; 1329.0bp to feature; MODIFIER	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0719139937	T -> C	LOC_Os07g32210-LOC_Os07g32220	intergenic_region ; MODIFIER	silent_mutation	Average:44.408; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719139937	2.44E-07	NA	mr1076	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.74E-07	1.18E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	6.87E-08	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.32E-08	6.63E-10	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	5.26E-08	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.23E-11	9.86E-13	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.89E-06	2.89E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.87E-07	1.21E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.40E-07	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.19E-07	2.49E-06	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.97E-08	NA	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	5.14E-06	5.31E-06	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	7.50E-06	NA	mr1139	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	8.01E-06	NA	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.15E-06	2.15E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.86E-06	NA	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	8.84E-08	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.79E-09	1.79E-09	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.08E-13	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.13E-13	3.56E-13	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.38E-06	3.06E-07	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.27E-10	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	9.86E-11	1.93E-08	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	7.73E-06	NA	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.05E-06	NA	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.92E-08	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.31E-06	1.89E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.83E-07	NA	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	7.61E-07	7.58E-07	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.96E-10	NA	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.44E-08	2.68E-07	mr1070_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.84E-15	1.84E-15	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.14E-15	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.09E-09	9.99E-12	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.04E-19	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.00E-11	8.02E-16	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.96E-09	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.98E-07	3.53E-07	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.12E-14	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.42E-10	1.62E-10	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	9.12E-14	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	9.79E-12	2.04E-11	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.15E-14	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.28E-12	8.67E-13	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	NA	1.06E-06	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	5.59E-11	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	8.30E-09	8.30E-09	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.98E-10	NA	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.34E-09	2.61E-07	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	7.97E-24	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	6.22E-15	4.13E-17	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.08E-10	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.51E-10	3.51E-10	mr1264_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	3.09E-13	NA	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	1.92E-09	1.90E-13	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	4.04E-09	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	2.88E-07	1.79E-06	mr1437_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	NA	3.32E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	8.86E-06	8.86E-06	mr1878_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	7.42E-07	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719139937	8.18E-07	9.79E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251