| Variant ID: vg0719131362 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19131362 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 117. )
ATTAAAAACTTTTGTGAAATATGTAAAACTATATGTATACACAAAAGTATATTTAACAATGAATCAAATGATAGAGAAAGAATTAATAATTACTTAAATT[T/C]
TTTAATAAGACGAACGGTCAAATATGTTAAAAAAGTCAACGGCGTCAAACATTTAGGGATGGAGGGAGTAGAACCATAGAAAAAGAATGAAGCGAGAGGA
TCCTCTCGCTTCATTCTTTTTCTATGGTTCTACTCCCTCCATCCCTAAATGTTTGACGCCGTTGACTTTTTTAACATATTTGACCGTTCGTCTTATTAAA[A/G]
AATTTAAGTAATTATTAATTCTTTCTCTATCATTTGATTCATTGTTAAATATACTTTTGTGTATACATATAGTTTTACATATTTCACAAAAGTTTTTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 45.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 80.60% | 19.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 17.50% | 82.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 75.50% | 24.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 73.30% | 26.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 96.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.40% | 67.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719131362 | T -> C | LOC_Os07g32190.1 | upstream_gene_variant ; 4363.0bp to feature; MODIFIER | silent_mutation | Average:55.267; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0719131362 | T -> C | LOC_Os07g32180-LOC_Os07g32190 | intergenic_region ; MODIFIER | silent_mutation | Average:55.267; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719131362 | NA | 1.80E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 8.26E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 4.87E-11 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 5.23E-10 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 5.58E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | 8.21E-18 | 5.29E-33 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 1.18E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | 1.15E-13 | 6.29E-09 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | 5.33E-18 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719131362 | NA | 3.59E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/