\
| Variant ID: vg0719120113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19120113 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGTTTTTCCTATTCCTACGTTTTCTCAATCCTGCGAATCAAAGGGCTATATAGGAAAAATTTCTACAGGAATGAGATCCTCTAAAATTCCTATGATTTT[C/T]
CTTTGAATTAAAGGGGGCCTTAACTTCTTTTTGCGGGTTATTTGCAAGGGAACACATTGGGCAAGATAATGGTCATTGCTGCTCAAGGATGAAGAGAGCA
TGCTCTCTTCATCCTTGAGCAGCAATGACCATTATCTTGCCCAATGTGTTCCCTTGCAAATAACCCGCAAAAAGAAGTTAAGGCCCCCTTTAATTCAAAG[G/A]
AAAATCATAGGAATTTTAGAGGATCTCATTCCTGTAGAAATTTTTCCTATATAGCCCTTTGATTCGCAGGATTGAGAAAACGTAGGAATAGGAAAAACGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.60% | 6.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719120113 | C -> T | LOC_Os07g32180.1 | upstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:34.454; most accessible tissue: Callus, score: 50.327 | N | N | N | N |
| vg0719120113 | C -> T | LOC_Os07g32180-LOC_Os07g32190 | intergenic_region ; MODIFIER | silent_mutation | Average:34.454; most accessible tissue: Callus, score: 50.327 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719120113 | NA | 4.19E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 1.16E-08 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 5.10E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | 9.11E-06 | 1.12E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 7.65E-10 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | 3.35E-06 | 2.06E-10 | mr1246 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 2.28E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 3.45E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 8.79E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 4.33E-09 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719120113 | NA | 3.11E-07 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |