\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719058961:

Variant ID: vg0719058961 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19058961
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATAAGAGGGGAAAGAGAGGGTGACGTGGAGACCTGACATGTGGGGCCCACGTGGGTCCCACCTGACTCAGCCGCCACGTAGACCAAAACCGGGGTCAAA[A/G]
CCACCAAAGGATCTCGGGTGTCCGGTTTTAAATAGTTAAAAGGGACCCAGCATATCTGGTTTTGCGGTTCGAGGACGTTTTCGTATCACTATGACAAGTT

Reverse complement sequence

AACTTGTCATAGTGATACGAAAACGTCCTCGAACCGCAAAACCAGATATGCTGGGTCCCTTTTAACTATTTAAAACCGGACACCCGAGATCCTTTGGTGG[T/C]
TTTGACCCCGGTTTTGGTCTACGTGGCGGCTGAGTCAGGTGGGACCCACGTGGGCCCCACATGTCAGGTCTCCACGTCACCCTCTCTTTCCCCTCTTATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 4.30% 18.94% 45.32% NA
All Indica  2759 14.00% 0.30% 14.06% 71.66% NA
All Japonica  1512 68.70% 12.60% 14.22% 4.56% NA
Aus  269 4.10% 0.00% 77.70% 18.22% NA
Indica I  595 7.40% 0.00% 16.13% 76.47% NA
Indica II  465 5.80% 1.70% 13.12% 79.35% NA
Indica III  913 20.40% 0.00% 10.19% 69.44% NA
Indica Intermediate  786 16.40% 0.00% 17.56% 66.03% NA
Temperate Japonica  767 96.00% 0.00% 2.74% 1.30% NA
Tropical Japonica  504 31.50% 36.90% 24.21% 7.34% NA
Japonica Intermediate  241 59.30% 1.70% 29.88% 9.13% NA
VI/Aromatic  96 18.80% 4.20% 60.42% 16.67% NA
Intermediate  90 35.60% 2.20% 27.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719058961 A -> DEL N N silent_mutation Average:73.286; most accessible tissue: Callus, score: 97.798 N N N N
vg0719058961 A -> G LOC_Os07g32060.1 upstream_gene_variant ; 1801.0bp to feature; MODIFIER silent_mutation Average:73.286; most accessible tissue: Callus, score: 97.798 N N N N
vg0719058961 A -> G LOC_Os07g32040.1 downstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:73.286; most accessible tissue: Callus, score: 97.798 N N N N
vg0719058961 A -> G LOC_Os07g32050.1 intron_variant ; MODIFIER silent_mutation Average:73.286; most accessible tissue: Callus, score: 97.798 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719058961 8.63E-10 1.26E-12 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.14E-10 1.40E-14 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.11E-15 2.47E-18 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.21E-11 3.21E-11 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 6.92E-09 1.08E-09 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 9.03E-10 6.61E-11 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 5.18E-11 1.56E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 8.84E-09 3.81E-10 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.76E-08 6.26E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.97E-07 3.97E-07 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.53E-08 NA mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 2.17E-13 2.17E-13 mr1204 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.60E-16 4.03E-19 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.87E-09 6.24E-11 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.42E-12 8.39E-12 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.27E-09 3.27E-09 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.49E-07 4.59E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 8.31E-09 3.87E-10 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.48E-07 NA mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 5.28E-07 1.31E-07 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.55E-10 2.01E-12 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.73E-13 2.36E-11 mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 4.11E-24 4.11E-24 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.66E-14 2.60E-20 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.34E-21 8.27E-29 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.51E-14 7.60E-14 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.66E-06 NA mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 8.86E-17 7.36E-19 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 4.06E-18 3.50E-19 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 5.88E-17 5.01E-19 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 2.53E-15 2.53E-15 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 2.09E-13 1.12E-09 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 3.54E-22 6.10E-28 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 9.73E-09 9.74E-09 mr1233_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.81E-07 1.81E-07 mr1264_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 7.80E-16 1.96E-21 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 5.50E-12 8.99E-11 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 1.40E-07 NA mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 2.05E-09 2.05E-09 mr1878_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719058961 2.58E-11 4.39E-11 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251