| Variant ID: vg0719058656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19058656 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 92. )
CCCCTCCTCCTCCTCCCTGCCTTCACCTTCCGCCACCGCGGCCGCCAGCCGCCTCTCCCCGCTCGCGTGGTTCCTCCTCGACGCGTTCCGCCGCCACCAG[C/T]
GTTGAGGCCCGCCCGTCGTCGCAGACCTCTCCAAGCTCCGTCGTGTGGCTCCCAAGCTCGTCGCCGAGGTCCTCAGCACTCGCCCGCCACCGCCGCCGCC
GGCGGCGGCGGTGGCGGGCGAGTGCTGAGGACCTCGGCGACGAGCTTGGGAGCCACACGACGGAGCTTGGAGAGGTCTGCGACGACGGGCGGGCCTCAAC[G/A]
CTGGTGGCGGCGGAACGCGTCGAGGAGGAACCACGCGAGCGGGGAGAGGCGGCTGGCGGCCGCGGTGGCGGAAGGTGAAGGCAGGGAGGAGGAGGAGGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 43.40% | 0.19% | 2.67% | NA |
| All Indica | 2759 | 79.90% | 15.30% | 0.33% | 4.53% | NA |
| All Japonica | 1512 | 18.10% | 81.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.30% | 8.40% | 0.17% | 1.18% | NA |
| Indica II | 465 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.90% | 18.80% | 0.77% | 6.46% | NA |
| Indica Intermediate | 786 | 72.80% | 19.60% | 0.13% | 7.51% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.00% | 69.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719058656 | C -> DEL | N | N | silent_mutation | Average:67.619; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg0719058656 | C -> T | LOC_Os07g32060.1 | upstream_gene_variant ; 2106.0bp to feature; MODIFIER | silent_mutation | Average:67.619; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg0719058656 | C -> T | LOC_Os07g32040.1 | downstream_gene_variant ; 2701.0bp to feature; MODIFIER | silent_mutation | Average:67.619; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg0719058656 | C -> T | LOC_Os07g32050.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.619; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719058656 | NA | 9.14E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | NA | 9.56E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | NA | 2.41E-11 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | NA | 3.22E-10 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | 1.46E-21 | 1.79E-35 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | 1.78E-06 | 7.78E-08 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | 2.90E-15 | 5.89E-10 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | 8.52E-20 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | NA | 1.93E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719058656 | 7.38E-14 | 7.13E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/