| Variant ID: vg0719057867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19057867 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAACCAAAGTTCAAAGCCCCTCTGTGCATGGAGCGGAGTTTTCATGTTCTGCACGTGAGCACGTTCAGGAGGGGACACAAAGCATATGCAGAATGGAAAA[A/G]
GTACACCGAAGGTCCCTCAACTTGTCATCCGGATACAAAATCGCCCTCCAACCGTAAAACCAGATATATAGGGTCCCTTAACTATATAAAACCGGTCAAA
TTTGACCGGTTTTATATAGTTAAGGGACCCTATATATCTGGTTTTACGGTTGGAGGGCGATTTTGTATCCGGATGACAAGTTGAGGGACCTTCGGTGTAC[T/C]
TTTTCCATTCTGCATATGCTTTGTGTCCCCTCCTGAACGTGCTCACGTGCAGAACATGAAAACTCCGCTCCATGCACAGAGGGGCTTTGAACTTTGGTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 29.30% | 0.19% | 2.52% | NA |
| All Indica | 2759 | 91.00% | 4.40% | 0.33% | 4.28% | NA |
| All Japonica | 1512 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 1.50% | 0.00% | 1.34% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.00% | 5.90% | 0.11% | 7.01% | NA |
| Indica Intermediate | 786 | 87.70% | 5.60% | 0.89% | 5.85% | NA |
| Temperate Japonica | 767 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.70% | 67.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719057867 | A -> DEL | N | N | silent_mutation | Average:69.979; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0719057867 | A -> G | LOC_Os07g32050.1 | upstream_gene_variant ; 176.0bp to feature; MODIFIER | silent_mutation | Average:69.979; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0719057867 | A -> G | LOC_Os07g32060.1 | upstream_gene_variant ; 2895.0bp to feature; MODIFIER | silent_mutation | Average:69.979; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0719057867 | A -> G | LOC_Os07g32040.1 | downstream_gene_variant ; 1912.0bp to feature; MODIFIER | silent_mutation | Average:69.979; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0719057867 | A -> G | LOC_Os07g32040-LOC_Os07g32050 | intergenic_region ; MODIFIER | silent_mutation | Average:69.979; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719057867 | 9.86E-16 | 2.29E-29 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 6.05E-15 | 1.16E-10 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 9.48E-20 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 1.22E-13 | 2.04E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 3.37E-12 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 3.05E-13 | 1.28E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 5.15E-17 | 5.39E-38 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 4.11E-13 | 4.11E-13 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | 1.24E-22 | 4.35E-46 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719057867 | NA | 5.68E-10 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/