| Variant ID: vg0719056561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19056561 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCGTGTTTATCGTCACTTCACCTTAAACGAAAAACAAAAATATTAAATGGCTGTTGACATAAAATTTAAGAGACCACCTATACATTTGTCGACAAATTTT[C/T]
TCCTAAAAATCTGACAGATGTAATTATAGTACAATCGTAGTGCACAATATAAATCATTCTAGTATTTCCCACATTCATATTGATGTTAATGAATCTAGAT
ATCTAGATTCATTAACATCAATATGAATGTGGGAAATACTAGAATGATTTATATTGTGCACTACGATTGTACTATAATTACATCTGTCAGATTTTTAGGA[G/A]
AAAATTTGTCGACAAATGTATAGGTGGTCTCTTAAATTTTATGTCAACAGCCATTTAATATTTTTGTTTTTCGTTTAAGGTGAAGTGACGATAAACACGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 40.20% | 59.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719056561 | C -> T | LOC_Os07g32050.1 | upstream_gene_variant ; 1482.0bp to feature; MODIFIER | silent_mutation | Average:44.864; most accessible tissue: Callus, score: 78.294 | N | N | N | N |
| vg0719056561 | C -> T | LOC_Os07g32060.1 | upstream_gene_variant ; 4201.0bp to feature; MODIFIER | silent_mutation | Average:44.864; most accessible tissue: Callus, score: 78.294 | N | N | N | N |
| vg0719056561 | C -> T | LOC_Os07g32040.1 | downstream_gene_variant ; 606.0bp to feature; MODIFIER | silent_mutation | Average:44.864; most accessible tissue: Callus, score: 78.294 | N | N | N | N |
| vg0719056561 | C -> T | LOC_Os07g32040-LOC_Os07g32050 | intergenic_region ; MODIFIER | silent_mutation | Average:44.864; most accessible tissue: Callus, score: 78.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719056561 | NA | 6.04E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 3.97E-13 | 1.35E-29 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 1.26E-15 | 2.89E-10 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 2.35E-17 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 4.54E-14 | 5.96E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 3.38E-11 | 9.29E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 4.81E-14 | 1.54E-06 | mr1083 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 1.85E-15 | 2.49E-39 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 9.22E-13 | 9.23E-13 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719056561 | 8.65E-20 | 4.92E-46 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/