\
| Variant ID: vg0719049124 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 19049124 |
| Reference Allele: AAACG | Alternative Allele: GAACG,A |
| Primary Allele: GAACG | Secondary Allele: AAACG |
Inferred Ancestral Allele: Not determined.
GAACTTGAATTGAATTTAAACTTACATATTTGTATAGTGATATATCACATATTAATATATATTTTTAATTTTTTTTATAACCATTTACGTGACATGTAAA[AAACG/GAACG,A]
AACGAACATCCCCTAGATTTTAGAATAATTTTCCCCTAAAGAAGAGAGAAAGAGATAGTACCCACCCTAAACATTGTATAGATGTTTTGTCAACCGATTC
GAATCGGTTGACAAAACATCTATACAATGTTTAGGGTGGGTACTATCTCTTTCTCTCTTCTTTAGGGGAAAATTATTCTAAAATCTAGGGGATGTTCGTT[CGTTT/CGTTC,T]
TTTACATGTCACGTAAATGGTTATAAAAAAAATTAAAAATATATATTAATATGTGATATATCACTATACAAATATGTAAGTTTAAATTCAATTCAAGTTC
| Populations | Population Size | Frequency of GAACG(primary allele) | Frequency of AAACG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 23.10% | 0.04% | 0.02% | A: 0.06% |
| All Indica | 2759 | 98.80% | 1.00% | 0.04% | 0.04% | A: 0.11% |
| All Japonica | 1512 | 32.00% | 68.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.50% | 0.22% | 0.22% | A: 0.65% |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719049124 | AAACG -> DEL | N | N | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> GAACG | LOC_Os07g32040.1 | upstream_gene_variant ; 4505.0bp to feature; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> GAACG | LOC_Os07g32020.1 | downstream_gene_variant ; 892.0bp to feature; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> GAACG | LOC_Os07g32020-LOC_Os07g32040 | intergenic_region ; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> A | LOC_Os07g32040.1 | upstream_gene_variant ; 4504.0bp to feature; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> A | LOC_Os07g32020.1 | downstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0719049124 | AAACG -> A | LOC_Os07g32020-LOC_Os07g32040 | intergenic_region ; MODIFIER | silent_mutation | Average:38.799; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719049124 | NA | 1.72E-15 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719049124 | NA | 5.11E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.05E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 8.96E-10 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 6.65E-09 | NA | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.10E-06 | 7.91E-08 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.14E-08 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 5.11E-10 | 7.04E-36 | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 3.15E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 4.31E-10 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.64E-08 | NA | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 4.35E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 1.99E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.57E-06 | 6.25E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 5.13E-07 | 5.13E-07 | mr1212 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 2.79E-18 | 1.82E-45 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 9.79E-11 | 3.27E-15 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.60E-08 | NA | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 6.08E-08 | 3.02E-10 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.43E-07 | NA | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 4.24E-06 | 4.27E-08 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 4.50E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 5.36E-08 | 2.69E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.71E-55 | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.30E-09 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.22E-08 | 2.87E-10 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 9.32E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 2.87E-07 | NA | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 9.69E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 5.76E-12 | 9.31E-39 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 7.91E-09 | 1.32E-12 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.85E-09 | NA | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 8.68E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.00E-38 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 4.63E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 6.09E-45 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.16E-11 | 4.01E-41 | mr1620 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.30E-07 | 3.86E-10 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.69E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 9.99E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 1.09E-20 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.73E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.30E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 1.14E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 2.84E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 4.41E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 9.80E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 4.09E-07 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.58E-07 | NA | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 2.14E-08 | 2.31E-13 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 6.65E-15 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.73E-07 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 6.64E-10 | NA | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 8.77E-07 | 5.99E-08 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.17E-08 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 9.67E-07 | NA | mr1104_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 3.30E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.93E-12 | 8.63E-43 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.91E-09 | 3.27E-12 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 4.92E-12 | 8.61E-29 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 5.68E-63 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.24E-10 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.18E-07 | 3.69E-11 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 2.42E-16 | 3.99E-67 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 3.34E-10 | 4.27E-14 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 2.42E-08 | NA | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 5.38E-39 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.29E-12 | 4.48E-56 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 4.88E-07 | 9.24E-09 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 1.39E-09 | 6.09E-24 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | 4.99E-06 | NA | mr1949_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719049124 | NA | 3.68E-19 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |