\
| Variant ID: vg0719044808 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19044808 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAGAATTAGTATGATTTTTTGAGAGCAACTTTTATATAGAAACTTTTTACAAACAACGCACTGTTTAACAATCTGAAAAATGTGTGCATGGAGAACG[T/A]
GGACGGTGAGTTCCGAGGATAGATTCTAATCTCTCAGGTGGACATCCACCCGTTTCTTTCATGCCACCTAAATGATTATGAAAAAATTCGAAAAAATTTT
AAAATTTTTTCGAATTTTTTCATAATCATTTAGGTGGCATGAAAGAAACGGGTGGATGTCCACCTGAGAGATTAGAATCTATCCTCGGAACTCACCGTCC[A/T]
CGTTCTCCATGCACACATTTTTCAGATTGTTAAACAGTGCGTTGTTTGTAAAAAGTTTCTATATAAAAGTTGCTCTCAAAAAATCATACTAATTCTTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 16.50% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 50.20% | 48.30% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 34.00% | 63.20% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.80% | 42.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719044808 | T -> A | LOC_Os07g32020.1 | upstream_gene_variant ; 1023.0bp to feature; MODIFIER | silent_mutation | Average:33.29; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0719044808 | T -> A | LOC_Os07g32010-LOC_Os07g32020 | intergenic_region ; MODIFIER | silent_mutation | Average:33.29; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719044808 | NA | 9.22E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 1.76E-06 | NA | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 9.15E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 9.81E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 7.63E-08 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 5.55E-11 | NA | mr1213 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 2.74E-07 | 1.12E-09 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 2.38E-06 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 4.92E-06 | 4.37E-07 | mr1246 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 4.36E-07 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 4.27E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 1.94E-06 | NA | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 2.11E-07 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 1.27E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 1.99E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 7.18E-06 | mr1751 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 6.61E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 3.91E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | 9.38E-07 | NA | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 1.01E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719044808 | NA | 6.42E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |