RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0719018483:

Variant ID: vg0719018483 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19018483
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAGGGAGCTACTATGATAATAATGGAGTGTGATTTTTATCAATTCAATTTGCTTACTTGATTTATCATTGCCCTGTTTGGTCTTTCGACTTAGCCAAT[A/G]
AGGACTGAAGGTTTTTAATAGCTTTTGCGGGTTTTAGGCTCAATAAGGCTTAACAAAGGCTTTTAAGAAATCAGAAGCTAAGTATGGAACACCAAGCATA

Reverse complement sequence

TATGCTTGGTGTTCCATACTTAGCTTCTGATTTCTTAAAAGCCTTTGTTAAGCCTTATTGAGCCTAAAACCCGCAAAAGCTATTAAAAACCTTCAGTCCT[T/C]
ATTGGCTAAGTCGAAAGACCAAACAGGGCAATGATAAATCAAGTAAGCAAATTGAATTGATAAAAATCACACTCCATTATTATCATAGTAGCTCCCTGAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	23.50%	1.25%	0.80%	NA
All Indica	2759	98.70%	1.30%	0.04%	0.00%	NA
All Japonica	1512	26.10%	68.00%	3.51%	2.45%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	2.20%	95.70%	0.78%	1.30%	NA
Tropical Japonica	504	62.90%	30.20%	4.56%	2.38%	NA
Japonica Intermediate	241	24.90%	58.90%	9.96%	6.22%	NA
VI/Aromatic	96	77.10%	18.80%	3.12%	1.04%	NA
Intermediate	90	73.30%	24.40%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719018483	A -> DEL	N	N	silent_mutation	Average:5.323; most accessible tissue: Callus, score: 11.876	N	N	N	N
vg0719018483	A -> G	LOC_Os07g31980.1	downstream_gene_variant ; 168.0bp to feature; MODIFIER	silent_mutation	Average:5.323; most accessible tissue: Callus, score: 11.876	N	N	N	N
vg0719018483	A -> G	LOC_Os07g31960-LOC_Os07g31980	intergenic_region ; MODIFIER	silent_mutation	Average:5.323; most accessible tissue: Callus, score: 11.876	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719018483	2.56E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	2.50E-06	NA	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	NA	6.29E-07	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	8.24E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	2.48E-06	1.50E-33	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	6.85E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	1.89E-06	NA	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	2.98E-11	5.19E-40	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	3.39E-08	7.43E-12	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719018483	NA	1.24E-07	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 47 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0719018483:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact