\
| Variant ID: vg0719016102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19016102 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGCGGCGCTCAGCCGGTTCATTTCACGACTCGGCGAGTGGGGGATGCCCTTCTTCAAGCTGCTGAAGAAGACTGACAATTTTCAGTGGGGACCCGAAGCA[A/C,T]
AAAAAGCCTTTGAAGACTTCAAGAAACTTCTCACCACTCCACCAGTTTTGGCCTCACCACGTCCACAAGAGCCGCTACTGTTATATGTGTCGGCAACCTC
GAGGTTGCCGACACATATAACAGTAGCGGCTCTTGTGGACGTGGTGAGGCCAAAACTGGTGGAGTGGTGAGAAGTTTCTTGAAGTCTTCAAAGGCTTTTT[T/G,A]
TGCTTCGGGTCCCCACTGAAAATTGTCAGTCTTCTTCAGCAGCTTGAAGAAGGGCATCCCCCACTCGCCGAGTCGTGAAATGAACCGGCTGAGCGCCGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.20% | 1.00% | 16.19% | 56.28% | T: 0.36% |
| All Indica | 2759 | 4.10% | 1.40% | 9.53% | 84.45% | T: 0.51% |
| All Japonica | 1512 | 70.80% | 0.10% | 26.19% | 2.84% | NA |
| Aus | 269 | 1.90% | 1.90% | 28.25% | 66.91% | T: 1.12% |
| Indica I | 595 | 1.70% | 0.70% | 3.87% | 93.45% | T: 0.34% |
| Indica II | 465 | 7.30% | 0.20% | 8.17% | 83.87% | T: 0.43% |
| Indica III | 913 | 3.60% | 2.20% | 13.80% | 79.74% | T: 0.66% |
| Indica Intermediate | 786 | 4.50% | 1.90% | 9.67% | 83.46% | T: 0.51% |
| Temperate Japonica | 767 | 97.10% | 0.00% | 2.09% | 0.78% | NA |
| Tropical Japonica | 504 | 33.90% | 0.40% | 61.11% | 4.56% | NA |
| Japonica Intermediate | 241 | 64.30% | 0.00% | 29.88% | 5.81% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 8.33% | 70.83% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 24.44% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719016102 | A -> DEL | N | N | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016102 | A -> T | LOC_Os07g31980.1 | downstream_gene_variant ; 2549.0bp to feature; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016102 | A -> T | LOC_Os07g31960-LOC_Os07g31980 | intergenic_region ; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016102 | A -> C | LOC_Os07g31980.1 | downstream_gene_variant ; 2549.0bp to feature; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016102 | A -> C | LOC_Os07g31960-LOC_Os07g31980 | intergenic_region ; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719016102 | 4.46E-06 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 5.51E-09 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 9.68E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 1.51E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | 7.34E-06 | 1.73E-06 | mr1503 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 8.87E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 4.65E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | 1.07E-06 | NA | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 8.13E-07 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | NA | 4.45E-08 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016102 | 8.88E-06 | NA | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |