\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719016102:

Variant ID: vg0719016102 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19016102
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGCGCTCAGCCGGTTCATTTCACGACTCGGCGAGTGGGGGATGCCCTTCTTCAAGCTGCTGAAGAAGACTGACAATTTTCAGTGGGGACCCGAAGCA[A/C,T]
AAAAAGCCTTTGAAGACTTCAAGAAACTTCTCACCACTCCACCAGTTTTGGCCTCACCACGTCCACAAGAGCCGCTACTGTTATATGTGTCGGCAACCTC

Reverse complement sequence

GAGGTTGCCGACACATATAACAGTAGCGGCTCTTGTGGACGTGGTGAGGCCAAAACTGGTGGAGTGGTGAGAAGTTTCTTGAAGTCTTCAAAGGCTTTTT[T/G,A]
TGCTTCGGGTCCCCACTGAAAATTGTCAGTCTTCTTCAGCAGCTTGAAGAAGGGCATCCCCCACTCGCCGAGTCGTGAAATGAACCGGCTGAGCGCCGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.20% 1.00% 16.19% 56.28% T: 0.36%
All Indica  2759 4.10% 1.40% 9.53% 84.45% T: 0.51%
All Japonica  1512 70.80% 0.10% 26.19% 2.84% NA
Aus  269 1.90% 1.90% 28.25% 66.91% T: 1.12%
Indica I  595 1.70% 0.70% 3.87% 93.45% T: 0.34%
Indica II  465 7.30% 0.20% 8.17% 83.87% T: 0.43%
Indica III  913 3.60% 2.20% 13.80% 79.74% T: 0.66%
Indica Intermediate  786 4.50% 1.90% 9.67% 83.46% T: 0.51%
Temperate Japonica  767 97.10% 0.00% 2.09% 0.78% NA
Tropical Japonica  504 33.90% 0.40% 61.11% 4.56% NA
Japonica Intermediate  241 64.30% 0.00% 29.88% 5.81% NA
VI/Aromatic  96 20.80% 0.00% 8.33% 70.83% NA
Intermediate  90 32.20% 0.00% 24.44% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719016102 A -> DEL N N silent_mutation Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 N N N N
vg0719016102 A -> T LOC_Os07g31980.1 downstream_gene_variant ; 2549.0bp to feature; MODIFIER silent_mutation Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 N N N N
vg0719016102 A -> T LOC_Os07g31960-LOC_Os07g31980 intergenic_region ; MODIFIER silent_mutation Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 N N N N
vg0719016102 A -> C LOC_Os07g31980.1 downstream_gene_variant ; 2549.0bp to feature; MODIFIER silent_mutation Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 N N N N
vg0719016102 A -> C LOC_Os07g31960-LOC_Os07g31980 intergenic_region ; MODIFIER silent_mutation Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719016102 4.46E-06 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 5.51E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 9.68E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 1.51E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 7.34E-06 1.73E-06 mr1503 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 8.87E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 4.65E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 1.07E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 8.13E-07 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 NA 4.45E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719016102 8.88E-06 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251