\
| Variant ID: vg0719016083 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19016083 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAAACTGACTGGTTGCATGGCGGCGCTCAGCCGGTTCATTTCACGACTCGGCGAGTGGGGGATGCCCTTCTTCAAGCTGCTGAAGAAGACTGACAATTT[T/C]
CAGTGGGGACCCGAAGCAAAAAAAGCCTTTGAAGACTTCAAGAAACTTCTCACCACTCCACCAGTTTTGGCCTCACCACGTCCACAAGAGCCGCTACTGT
ACAGTAGCGGCTCTTGTGGACGTGGTGAGGCCAAAACTGGTGGAGTGGTGAGAAGTTTCTTGAAGTCTTCAAAGGCTTTTTTTGCTTCGGGTCCCCACTG[A/G]
AAATTGTCAGTCTTCTTCAGCAGCTTGAAGAAGGGCATCCCCCACTCGCCGAGTCGTGAAATGAACCGGCTGAGCGCCGCCATGCAACCAGTCAGTTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 0.30% | 9.71% | 44.05% | NA |
| All Indica | 2759 | 31.20% | 0.40% | 8.34% | 60.09% | NA |
| All Japonica | 1512 | 73.00% | 0.00% | 10.98% | 16.01% | NA |
| Aus | 269 | 49.40% | 0.40% | 12.27% | 37.92% | NA |
| Indica I | 595 | 15.30% | 0.20% | 7.06% | 77.48% | NA |
| Indica II | 465 | 28.00% | 0.40% | 7.74% | 63.87% | NA |
| Indica III | 913 | 41.20% | 0.40% | 10.95% | 47.43% | NA |
| Indica Intermediate | 786 | 33.50% | 0.50% | 6.62% | 59.41% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.65% | 2.61% | NA |
| Tropical Japonica | 504 | 43.10% | 0.00% | 25.00% | 31.94% | NA |
| Japonica Intermediate | 241 | 60.20% | 0.00% | 14.52% | 25.31% | NA |
| VI/Aromatic | 96 | 35.40% | 0.00% | 16.67% | 47.92% | NA |
| Intermediate | 90 | 46.70% | 0.00% | 15.56% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719016083 | T -> DEL | N | N | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016083 | T -> C | LOC_Os07g31980.1 | downstream_gene_variant ; 2568.0bp to feature; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg0719016083 | T -> C | LOC_Os07g31960-LOC_Os07g31980 | intergenic_region ; MODIFIER | silent_mutation | Average:6.24; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719016083 | NA | 8.54E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 1.60E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 3.57E-06 | NA | mr1088_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 5.82E-06 | 6.97E-07 | mr1088_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 8.84E-06 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 7.01E-09 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 1.20E-06 | mr1212_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 2.56E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 9.23E-07 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 3.10E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 1.62E-06 | NA | mr1404_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 2.37E-06 | 3.09E-08 | mr1404_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 7.62E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | NA | 7.14E-07 | mr1439_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 7.64E-07 | NA | mr1620_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719016083 | 9.71E-07 | 5.20E-08 | mr1620_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |