\
| Variant ID: vg0719013107 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19013107 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.30, others allele: 0.00, population size: 53. )
TCATTGGGCAACAAGACGTCGATGGAACAGCGGTCTTTCGCACCCCCCAGCAGAACGCGGTTGCAGCAATCACTCTCCTCGACACCCTCCTCAAGGAAGA[T/C]
GCACTCAACCAAGCCGATCATGTTGTCAACATCTTGAACCAGACGAAGACCATGATCGCTGCCTCGGTTCCAGCCAACTCTGCAAGCACCCGTACCCCGA
TCGGGGTACGGGTGCTTGCAGAGTTGGCTGGAACCGAGGCAGCGATCATGGTCTTCGTCTGGTTCAAGATGTTGACAACATGATCGGCTTGGTTGAGTGC[A/G]
TCTTCCTTGAGGAGGGTGTCGAGGAGAGTGATTGCTGCAACCGCGTTCTGCTGGGGGGTGCGAAAGACCGCTGTTCCATCGACGTCTTGTTGCCCAATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.50% | 24.50% | 30.05% | 16.95% | NA |
| All Indica | 2759 | 41.40% | 2.80% | 47.84% | 8.01% | NA |
| All Japonica | 1512 | 0.30% | 68.50% | 1.52% | 29.70% | NA |
| Aus | 269 | 69.50% | 0.40% | 10.41% | 19.70% | NA |
| Indica I | 595 | 29.70% | 1.30% | 55.63% | 13.28% | NA |
| Indica II | 465 | 29.70% | 3.20% | 56.56% | 10.54% | NA |
| Indica III | 913 | 56.00% | 2.50% | 38.34% | 3.18% | NA |
| Indica Intermediate | 786 | 40.10% | 3.90% | 47.84% | 8.14% | NA |
| Temperate Japonica | 767 | 0.40% | 95.60% | 0.65% | 3.39% | NA |
| Tropical Japonica | 504 | 0.00% | 31.50% | 2.38% | 66.07% | NA |
| Japonica Intermediate | 241 | 0.40% | 59.80% | 2.49% | 37.34% | NA |
| VI/Aromatic | 96 | 1.00% | 19.80% | 18.75% | 60.42% | NA |
| Intermediate | 90 | 14.40% | 28.90% | 34.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719013107 | T -> DEL | N | N | silent_mutation | Average:10.826; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| vg0719013107 | T -> C | LOC_Os07g31960.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:10.826; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| vg0719013107 | T -> C | LOC_Os07g31960-LOC_Os07g31980 | intergenic_region ; MODIFIER | silent_mutation | Average:10.826; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719013107 | NA | 3.70E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 2.63E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 7.58E-06 | NA | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 3.15E-08 | 2.48E-34 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 4.36E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 1.66E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 2.03E-07 | NA | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 3.38E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 1.12E-07 | NA | mr1620 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 6.13E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 6.09E-06 | 9.82E-18 | mr1740 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 7.00E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 5.45E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 6.81E-10 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 1.45E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | NA | 3.15E-15 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 7.16E-08 | 1.21E-26 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 7.94E-07 | NA | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719013107 | 4.58E-06 | 2.58E-23 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |