\
| Variant ID: vg0718998483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18998483 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 107. )
TAGAATATGTAATGGATCATGACTTGGGTATTATGTTTCCTTGTATATTACGGAACGGCCTGAAGTCCTGGTTTGATGATATTGTAAAGTAGATTTAAGA[A/G]
ACCGATACCGTATTGGTTAAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGGCAGGAGGCCCTCTAGGGGGCATGACACAACTAGATC
GATCTAGTTGTGTCATGCCCCCTAGAGGGCCTCCTGCCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTTAACCAATACGGTATCGGT[T/C]
TCTTAAATCTACTTTACAATATCATCAAACCAGGACTTCAGGCCGTTCCGTAATATACAAGGAAACATAATACCCAAGTCATGATCCATTACATATTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 5.30% | 0.32% | 3.22% | NA |
| All Indica | 2759 | 87.20% | 7.00% | 0.43% | 5.33% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.13% | 0.26% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 3.40% | 0.34% | 2.02% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.90% | 8.20% | 0.33% | 8.54% | NA |
| Indica Intermediate | 786 | 82.10% | 9.80% | 0.89% | 7.25% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718998483 | A -> DEL | N | N | silent_mutation | Average:63.392; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| vg0718998483 | A -> G | LOC_Os07g31930.1 | upstream_gene_variant ; 1543.0bp to feature; MODIFIER | silent_mutation | Average:63.392; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| vg0718998483 | A -> G | LOC_Os07g31940.1 | upstream_gene_variant ; 3600.0bp to feature; MODIFIER | silent_mutation | Average:63.392; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| vg0718998483 | A -> G | LOC_Os07g31930-LOC_Os07g31940 | intergenic_region ; MODIFIER | silent_mutation | Average:63.392; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718998483 | 1.94E-07 | 2.30E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.45E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 9.31E-08 | 9.19E-08 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.44E-11 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.24E-13 | 6.06E-17 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.14E-16 | NA | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 7.20E-22 | 2.03E-26 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.90E-11 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.60E-16 | 9.17E-15 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.06E-08 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.55E-11 | 1.28E-14 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 8.04E-09 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.96E-15 | 1.38E-16 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.79E-07 | 8.86E-09 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.60E-11 | NA | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.75E-15 | 4.42E-14 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 7.97E-06 | NA | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.36E-06 | 1.11E-06 | mr1199 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.01E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.10E-09 | 1.08E-08 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.70E-12 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 7.51E-14 | 7.00E-21 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.86E-09 | NA | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.64E-10 | 4.52E-12 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.84E-11 | NA | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.69E-10 | 3.51E-13 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.44E-08 | 1.43E-09 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.66E-06 | NA | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.94E-08 | 1.50E-09 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 8.93E-19 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 8.85E-20 | 7.45E-26 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.75E-06 | NA | mr1264 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.61E-11 | NA | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.96E-13 | 2.30E-15 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 6.32E-07 | 2.76E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.13E-11 | NA | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.52E-14 | 1.21E-13 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.66E-07 | 2.41E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.24E-11 | NA | mr1620 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.11E-13 | 1.23E-15 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.72E-08 | NA | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.56E-10 | 1.67E-11 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 7.85E-06 | 4.68E-07 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | NA | 1.07E-06 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.59E-07 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.26E-13 | 1.05E-12 | mr1070_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.01E-06 | NA | mr1076_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.61E-06 | NA | mr1083_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.42E-06 | NA | mr1085_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.24E-12 | NA | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.38E-19 | 1.04E-20 | mr1088_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.47E-09 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.50E-17 | NA | mr1103_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.74E-11 | NA | mr1104_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.34E-09 | NA | mr1107_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 9.08E-08 | 1.06E-08 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.83E-06 | NA | mr1145_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.50E-07 | NA | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.97E-13 | 7.05E-15 | mr1224_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.14E-07 | NA | mr1226_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.01E-08 | NA | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.53E-10 | 4.65E-12 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.54E-18 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 6.27E-22 | 4.54E-27 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 6.63E-07 | 1.09E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.96E-13 | NA | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 5.38E-20 | 5.32E-24 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.96E-08 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | NA | 7.53E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 3.36E-08 | NA | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.32E-13 | 1.52E-12 | mr1437_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 9.12E-09 | NA | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 4.82E-15 | 1.15E-16 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 2.14E-07 | 1.86E-06 | mr1878_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718998483 | 1.92E-07 | 2.81E-08 | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |