\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718982411:

Variant ID: vg0718982411 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18982411
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCTTCCACTTCATCTTCTTCCATTTCAACACCTTGCTCTCCGTGGGATGTCCAACAGTTATAGCTTGGCATGAACCCCGACTTAAACAAGTGGAAAT[G/A]
AATAGTCCTAGATGCAGAATACTCCTTCTGATTCTTACACTTATTGCATGGACAACAAATAAAACCCCCTTTGCCTGTTAGCTTCGGCCACTCTCAAAAA

Reverse complement sequence

TTTTTGAGAGTGGCCGAAGCTAACAGGCAAAGGGGGTTTTATTTGTTGTCCATGCAATAAGTGTAAGAATCAGAAGGAGTATTCTGCATCTAGGACTATT[C/T]
ATTTCCACTTGTTTAAGTCGGGGTTCATGCCAAGCTATAACTGTTGGACATCCCACGGAGAGCAAGGTGTTGAAATGGAAGAAGATGAAGTGGAAGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 18.00% 1.48% 3.58% NA
All Indica  2759 63.10% 29.00% 1.96% 5.87% NA
All Japonica  1512 99.40% 0.10% 0.07% 0.40% NA
Aus  269 80.30% 14.90% 4.83% 0.00% NA
Indica I  595 23.40% 71.10% 3.36% 2.18% NA
Indica II  465 76.80% 21.70% 1.51% 0.00% NA
Indica III  913 82.40% 7.80% 0.66% 9.20% NA
Indica Intermediate  786 62.80% 26.20% 2.67% 8.27% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718982411 G -> DEL N N silent_mutation Average:14.181; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N
vg0718982411 G -> A LOC_Os07g31910.1 upstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:14.181; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N
vg0718982411 G -> A LOC_Os07g31920.1 upstream_gene_variant ; 75.0bp to feature; MODIFIER silent_mutation Average:14.181; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N
vg0718982411 G -> A LOC_Os07g31920-LOC_Os07g31930 intergenic_region ; MODIFIER silent_mutation Average:14.181; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718982411 NA 6.50E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718982411 8.93E-07 NA mr1246_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718982411 8.73E-06 NA mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718982411 NA 1.38E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251