Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718951893:

Variant ID: vg0718951893 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18951893
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTCCTACAGACATGAAAGAAGCCACCTACTACTGTCTACAGCCAAACTATTGTGCTTCTCTTGTCAAGTTCCAGTACTACGCCAAACTATTGTGCTT[C/T]
TCTTGTCAAGTTCCAGTACTACAAGCTGAATGGAACAATCAATTAACTCAAGGGGTTATAGCCACAAACTTCAGACTGAGTGATCCTTTCCACTGAAGCG

Reverse complement sequence

CGCTTCAGTGGAAAGGATCACTCAGTCTGAAGTTTGTGGCTATAACCCCTTGAGTTAATTGATTGTTCCATTCAGCTTGTAGTACTGGAACTTGACAAGA[G/A]
AAGCACAATAGTTTGGCGTAGTACTGGAACTTGACAAGAGAAGCACAATAGTTTGGCTGTAGACAGTAGTAGGTGGCTTCTTTCATGTCTGTAGGAAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 8.70% 4.21% 0.00% NA
All Indica  2759 90.40% 3.70% 5.87% 0.00% NA
All Japonica  1512 94.90% 3.40% 1.65% 0.00% NA
Aus  269 29.00% 68.40% 2.60% 0.00% NA
Indica I  595 87.60% 2.70% 9.75% 0.00% NA
Indica II  465 91.20% 3.00% 5.81% 0.00% NA
Indica III  913 92.20% 3.80% 3.94% 0.00% NA
Indica Intermediate  786 89.90% 4.80% 5.22% 0.00% NA
Temperate Japonica  767 99.10% 0.50% 0.39% 0.00% NA
Tropical Japonica  504 89.90% 7.10% 2.98% 0.00% NA
Japonica Intermediate  241 92.10% 5.00% 2.90% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718951893 C -> T LOC_Os07g31884.1 downstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:52.15; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0718951893 C -> T LOC_Os07g31870.1 intron_variant ; MODIFIER silent_mutation Average:52.15; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718951893 NA 5.24E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 4.82E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 9.07E-07 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 2.18E-06 2.18E-06 mr1212 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 9.53E-09 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 7.84E-11 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 2.54E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.58E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 7.31E-06 9.51E-08 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 8.60E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 9.58E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 3.36E-07 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.46E-08 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 6.90E-07 6.89E-07 mr1520 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.61E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.48E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.09E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 4.74E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 5.78E-06 5.78E-06 mr1663 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 7.63E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 8.17E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 3.37E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.80E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 9.06E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 2.30E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 4.31E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 1.85E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 7.68E-06 7.68E-06 mr1877_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 9.87E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718951893 NA 3.78E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251