Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718911344:

Variant ID: vg0718911344 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18911344
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCATTTTTGGGACGGAGAGAGTGCTAAGGCCCTGTTTAGTTCCTAAAACAAATTTCACATCGAATGTTTGGACACATGCATGGAGTATTAAATGTAGAC[A/G]
AAAAAAAAGTCAATTACACATATTGCGTGTAAATTGCGAGACGAATCTTTTAAGCCTAATTACGCTATGATTTGATAATGTTGTGGTACAGTAAACATTT

Reverse complement sequence

AAATGTTTACTGTACCACAACATTATCAAATCATAGCGTAATTAGGCTTAAAAGATTCGTCTCGCAATTTACACGCAATATGTGTAATTGACTTTTTTTT[T/C]
GTCTACATTTAATACTCCATGCATGTGTCCAAACATTCGATGTGAAATTTGTTTTAGGAACTAAACAGGGCCTTAGCACTCTCTCCGTCCCAAAAATGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	7.80%	3.39%	59.69%	NA
All Indica	2759	9.90%	12.30%	3.12%	74.74%	NA
All Japonica	1512	69.20%	0.10%	0.20%	30.42%	NA
Aus	269	2.60%	7.40%	24.16%	65.80%	NA
Indica I	595	3.40%	3.00%	4.20%	89.41%	NA
Indica II	465	2.40%	13.80%	1.72%	82.15%	NA
Indica III	913	13.80%	12.20%	4.27%	69.77%	NA
Indica Intermediate	786	14.80%	18.40%	1.78%	65.01%	NA
Temperate Japonica	767	96.10%	0.30%	0.00%	3.65%	NA
Tropical Japonica	504	32.70%	0.00%	0.60%	66.67%	NA
Japonica Intermediate	241	60.20%	0.00%	0.00%	39.83%	NA
VI/Aromatic	96	20.80%	0.00%	2.08%	77.08%	NA
Intermediate	90	34.40%	7.80%	4.44%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718911344	A -> DEL	N	N	silent_mutation	Average:32.071; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0718911344	A -> G	LOC_Os07g31810.1	upstream_gene_variant ; 4574.0bp to feature; MODIFIER	silent_mutation	Average:32.071; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0718911344	A -> G	LOC_Os07g31830.1	upstream_gene_variant ; 443.0bp to feature; MODIFIER	silent_mutation	Average:32.071; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0718911344	A -> G	LOC_Os07g31840.1	downstream_gene_variant ; 3600.0bp to feature; MODIFIER	silent_mutation	Average:32.071; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0718911344	A -> G	LOC_Os07g31810-LOC_Os07g31830	intergenic_region ; MODIFIER	silent_mutation	Average:32.071; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718911344	NA	3.17E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	5.40E-07	1.36E-08	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	7.84E-07	4.94E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	NA	1.08E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	2.11E-06	NA	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	1.63E-07	1.12E-08	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	1.70E-06	6.70E-08	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	1.33E-09	NA	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	5.35E-11	1.36E-13	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	6.79E-07	NA	mr1088_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	3.98E-08	6.86E-09	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	4.05E-07	NA	mr1103_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	1.67E-07	9.63E-08	mr1224_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	2.64E-09	NA	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	1.28E-10	2.20E-12	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	2.92E-07	1.96E-09	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	NA	3.65E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	NA	8.15E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718911344	NA	3.61E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251