\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718904841:

Variant ID: vg0718904841 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18904841
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTAGTGCACATTGAAGCTGGTGGGTACTGGTGGTTTTAGTCAAAGGGTATTTTAGTCATTAAGATAAAATTCAATACAGCAAAAGGATGTCAGCTAAC[A/G]
GCTCATGGACGGCGAGGGCACACAATAGAGGTAAAGAAAACACGATGGTATATTATTGAACTTGACAAAGTGAGTGGTAGATTGTAGAAGTGCGATAAAC

Reverse complement sequence

GTTTATCGCACTTCTACAATCTACCACTCACTTTGTCAAGTTCAATAATATACCATCGTGTTTTCTTTACCTCTATTGTGTGCCCTCGCCGTCCATGAGC[T/C]
GTTAGCTGACATCCTTTTGCTGTATTGAATTTTATCTTAATGACTAAAATACCCTTTGACTAAAACCACCAGTACCCACCAGCTTCAATGTGCACTAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 44.50% 0.66% 1.14% NA
All Indica  2759 78.10% 19.60% 0.47% 1.85% NA
All Japonica  1512 1.50% 98.40% 0.13% 0.00% NA
Aus  269 91.10% 3.00% 4.83% 1.12% NA
Indica I  595 97.50% 2.00% 0.50% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 57.10% 38.20% 0.77% 3.94% NA
Indica Intermediate  786 78.80% 19.00% 0.38% 1.91% NA
Temperate Japonica  767 1.60% 98.30% 0.13% 0.00% NA
Tropical Japonica  504 0.20% 99.60% 0.20% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 46.70% 50.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718904841 A -> DEL N N silent_mutation Average:47.42; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0718904841 A -> G LOC_Os07g31800.1 upstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:47.42; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0718904841 A -> G LOC_Os07g31810.1 downstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:47.42; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0718904841 A -> G LOC_Os07g31800-LOC_Os07g31810 intergenic_region ; MODIFIER silent_mutation Average:47.42; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718904841 NA 2.00E-32 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.18E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 1.62E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 4.17E-32 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 7.48E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 1.41E-11 7.35E-33 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 6.08E-10 6.65E-22 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 1.72E-07 3.18E-40 mr1213 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.72E-14 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 3.97E-14 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 4.85E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 3.39E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.44E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.24E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 1.92E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 6.12E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 7.31E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 9.24E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 6.15E-16 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 1.62E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 3.29E-38 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 1.49E-37 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.50E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 1.17E-11 2.18E-51 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 2.74E-15 1.60E-28 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 7.10E-09 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 5.88E-27 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 4.58E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 NA 2.52E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718904841 4.14E-06 5.06E-26 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251