\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718817715:

Variant ID: vg0718817715 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18817715
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTACTTGGAAGTCCAAGAAACAGGTAGCTGTCTCTCGATCTAGCACCGAGGTAGAACTTCAAGCTCTTGCTACTACCACTTCAGAAATTGTGTGGCTGC[A/G]
TTGGCTACTAGCTGATTTTGGTGTTTCTTGTGATGTCTCCACACCTCTTCTATGTGACAACACTGGAGCAATTCAAATTGCTAATGATCCGGTGAAACAT

Reverse complement sequence

ATGTTTCACCGGATCATTAGCAATTTGAATTGCTCCAGTGTTGTCACATAGAAGAGGTGTGGAGACATCACAAGAAACACCAAAATCAGCTAGTAGCCAA[T/C]
GCAGCCACACAATTTCTGAAGTGGTAGTAGCAAGAGCTTGAAGTTCTACCTCGGTGCTAGATCGAGAGACAGCTACCTGTTTCTTGGACTTCCAAGTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 7.30% 4.21% 28.99% NA
All Indica  2759 57.10% 2.60% 1.27% 39.04% NA
All Japonica  1512 71.30% 17.70% 10.45% 0.53% NA
Aus  269 24.20% 0.00% 0.37% 75.46% NA
Indica I  595 80.50% 3.90% 0.50% 15.13% NA
Indica II  465 83.70% 1.70% 0.43% 14.19% NA
Indica III  913 33.60% 3.20% 1.53% 61.66% NA
Indica Intermediate  786 51.00% 1.40% 2.04% 45.55% NA
Temperate Japonica  767 50.10% 31.60% 18.12% 0.26% NA
Tropical Japonica  504 95.80% 3.20% 0.99% 0.00% NA
Japonica Intermediate  241 87.60% 4.10% 5.81% 2.49% NA
VI/Aromatic  96 31.20% 0.00% 1.04% 67.71% NA
Intermediate  90 68.90% 7.80% 4.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718817715 A -> DEL LOC_Os07g31690.1 N frameshift_variant Average:61.528; most accessible tissue: Callus, score: 93.058 N N N N
vg0718817715 A -> G LOC_Os07g31690.1 missense_variant ; p.His689Arg; MODERATE nonsynonymous_codon ; H689R Average:61.528; most accessible tissue: Callus, score: 93.058 probably damaging -2.33 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718817715 NA 7.21E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 NA 3.64E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 3.30E-06 3.29E-06 mr1494 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 NA 1.45E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 NA 7.65E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 NA 4.66E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718817715 NA 1.07E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251