Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718741496:

Variant ID: vg0718741496 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18741496
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGACCGACGCCATCGTCGTCGAGTCGACGCTAGCTGAGCAGATCGAGCTTGTGTTCCCTTGTCAAATTAATACTCCCTCCATCCTAAAATGTTTGACGC[T/C]
ATTGATTTTTTTAAAAATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTT

Reverse complement sequence

AAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATTTTTAAAAAAATCAAT[A/G]
GCGTCAAACATTTTAGGATGGAGGGAGTATTAATTTGACAAGGGAACACAAGCTCGATCTGCTCAGCTAGCGTCGACTCGACGACGATGGCGTCGGTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 24.70% 0.04% 0.59% NA
All Indica  2759 97.80% 1.20% 0.00% 1.01% NA
All Japonica  1512 28.10% 71.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 96.80% 0.30% 0.00% 2.85% NA
Indica Intermediate  786 97.20% 2.50% 0.00% 0.25% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 58.50% 41.50% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718741496 T -> DEL N N silent_mutation Average:79.413; most accessible tissue: Minghui63 root, score: 89.635 N N N N
vg0718741496 T -> C LOC_Os07g31560.1 upstream_gene_variant ; 87.0bp to feature; MODIFIER silent_mutation Average:79.413; most accessible tissue: Minghui63 root, score: 89.635 N N N N
vg0718741496 T -> C LOC_Os07g31570.1 upstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:79.413; most accessible tissue: Minghui63 root, score: 89.635 N N N N
vg0718741496 T -> C LOC_Os07g31560-LOC_Os07g31570 intergenic_region ; MODIFIER silent_mutation Average:79.413; most accessible tissue: Minghui63 root, score: 89.635 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718741496 T C -0.04 -0.04 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718741496 NA 1.23E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718741496 2.61E-06 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718741496 NA 7.54E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718741496 1.79E-06 3.70E-37 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 4.41E-10 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.23E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 6.68E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 2.78E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 3.18E-07 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 4.44E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.57E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 3.85E-06 3.93E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 9.82E-08 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 2.71E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.30E-46 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 5.85E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.28E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 3.14E-07 2.12E-38 mr1733 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 3.57E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 8.33E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 8.26E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 3.28E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 2.46E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 6.09E-07 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.95E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 5.15E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.79E-50 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 2.90E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718741496 NA 1.71E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251