\
| Variant ID: vg0718664463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18664463 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACCGCCGAGACTCTATCGTTGTCGTCGCCTTTCCCGCCACCGTTGCTAACGCCGTCCCTACTGCCAGCCGCCACCCCTCTAGATCTGGCCGAAGCGACA[C/T]
GGATCTGGCGGTCTCCACTACTGCCACCCTAGGCAACTCCCTGGCTGCCCGAGTGTGAGGTCAGCGAGAAGCCCTGCCGCCACCGTCCTTGCGGCCGCGT
ACGCGGCCGCAAGGACGGTGGCGGCAGGGCTTCTCGCTGACCTCACACTCGGGCAGCCAGGGAGTTGCCTAGGGTGGCAGTAGTGGAGACCGCCAGATCC[G/A]
TGTCGCTTCGGCCAGATCTAGAGGGGTGGCGGCTGGCAGTAGGGACGGCGTTAGCAACGGTGGCGGGAAAGGCGACGACAACGATAGAGTCTCGGCGGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 7.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.50% | 17.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.90% | 42.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 19.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718664463 | C -> T | LOC_Os07g31470.1 | upstream_gene_variant ; 4146.0bp to feature; MODIFIER | silent_mutation | Average:73.699; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0718664463 | C -> T | LOC_Os07g31470-LOC_Os07g31480 | intergenic_region ; MODIFIER | silent_mutation | Average:73.699; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718664463 | 4.87E-07 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 3.37E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 2.36E-08 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 2.13E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 4.42E-11 | NA | mr1226 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 6.63E-06 | NA | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | NA | 5.95E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 7.15E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 2.42E-07 | NA | mr1560 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 7.34E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 1.56E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 5.22E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 2.93E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 1.42E-09 | NA | mr1107_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718664463 | 1.97E-09 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |