Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718659061:

Variant ID: vg0718659061 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18659061
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGTCGGCGCAACGCCCACGGCCGCATCCTGCACCAGCACTTGCTGCTGCTGCTGCTGCTGCGCCACCTGATCCATCCCGGCGAGGCCGCCCATGCCCGG[C/A,T]
GGCGCGACGGCGGTGGCCCACATTGCCGCCTCCTCGTCCATGAACGCCGCCATGCTCGCGCTGAAGCTGCCGTTGCCGTTCGACGACATGCCGCCGCCGC

Reverse complement sequence

GCGGCGGCGGCATGTCGTCGAACGGCAACGGCAGCTTCAGCGCGAGCATGGCGGCGTTCATGGACGAGGAGGCGGCAATGTGGGCCACCGCCGTCGCGCC[G/T,A]
CCGGGCATGGGCGGCCTCGCCGGGATGGATCAGGTGGCGCAGCAGCAGCAGCAGCAGCAAGTGCTGGTGCAGGATGCGGCCGTGGGCGTTGCGCCGACGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.80%	19.00%	0.17%	0.00%	T: 0.04%
All Indica	2759	79.00%	20.80%	0.18%	0.00%	NA
All Japonica	1512	82.60%	17.30%	0.13%	0.00%	NA
Aus	269	83.30%	16.40%	0.37%	0.00%	NA
Indica I	595	96.80%	2.90%	0.34%	0.00%	NA
Indica II	465	86.00%	14.00%	0.00%	0.00%	NA
Indica III	913	67.30%	32.50%	0.22%	0.00%	NA
Indica Intermediate	786	74.90%	24.90%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	58.90%	40.90%	0.20%	0.00%	NA
Japonica Intermediate	241	78.80%	20.70%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	0.00%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718659061	C -> A	LOC_Os07g31470.1	synonymous_variant ; p.Pro299Pro; LOW	synonymous_codon	Average:75.665; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N
vg0718659061	C -> T	LOC_Os07g31470.1	synonymous_variant ; p.Pro299Pro; LOW	synonymous_codon	Average:75.665; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718659061	NA	5.07E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.50E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	2.02E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	5.27E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	2.16E-07	NA	mr1086	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.67E-09	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	9.97E-08	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	4.43E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	6.04E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.50E-10	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.31E-09	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	7.02E-06	mr1131	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	4.96E-08	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	3.36E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.70E-10	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	1.31E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.42E-08	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	4.26E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	3.17E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	3.81E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	7.00E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	2.16E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.69E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.63E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	2.54E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	2.91E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	1.79E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	2.43E-09	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718659061	NA	2.46E-09	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251