\
| Variant ID: vg0718659061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18659061 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGTCGGCGCAACGCCCACGGCCGCATCCTGCACCAGCACTTGCTGCTGCTGCTGCTGCTGCGCCACCTGATCCATCCCGGCGAGGCCGCCCATGCCCGG[C/A,T]
GGCGCGACGGCGGTGGCCCACATTGCCGCCTCCTCGTCCATGAACGCCGCCATGCTCGCGCTGAAGCTGCCGTTGCCGTTCGACGACATGCCGCCGCCGC
GCGGCGGCGGCATGTCGTCGAACGGCAACGGCAGCTTCAGCGCGAGCATGGCGGCGTTCATGGACGAGGAGGCGGCAATGTGGGCCACCGCCGTCGCGCC[G/T,A]
CCGGGCATGGGCGGCCTCGCCGGGATGGATCAGGTGGCGCAGCAGCAGCAGCAGCAGCAAGTGCTGGTGCAGGATGCGGCCGTGGGCGTTGCGCCGACGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 19.00% | 0.17% | 0.00% | T: 0.04% |
| All Indica | 2759 | 79.00% | 20.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 82.60% | 17.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 83.30% | 16.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 67.30% | 32.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 74.90% | 24.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 58.90% | 40.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 20.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 0.00% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718659061 | C -> A | LOC_Os07g31470.1 | synonymous_variant ; p.Pro299Pro; LOW | synonymous_codon | Average:75.665; most accessible tissue: Zhenshan97 young leaf, score: 84.035 | N | N | N | N |
| vg0718659061 | C -> T | LOC_Os07g31470.1 | synonymous_variant ; p.Pro299Pro; LOW | synonymous_codon | Average:75.665; most accessible tissue: Zhenshan97 young leaf, score: 84.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718659061 | NA | 5.07E-11 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.50E-10 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 2.02E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 5.27E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 2.16E-07 | NA | mr1086 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.67E-09 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 9.97E-08 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 4.43E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 6.04E-08 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.50E-10 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.31E-09 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 7.02E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 4.96E-08 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 3.36E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.70E-10 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 1.31E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.42E-08 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 4.26E-08 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 3.17E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 3.81E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 7.00E-11 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 2.16E-11 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.69E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.63E-08 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 2.54E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | 2.91E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 1.79E-06 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 2.43E-09 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718659061 | NA | 2.46E-09 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |