\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718640985:

Variant ID: vg0718640985 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 18640985
Reference Allele: CGTAlternative Allele: TGT,C
Primary Allele: TGTSecondary Allele: CGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCAACAAGTCTTATTATTGTAATATTTCTAAATGTTTTACAATATAGTCATAAACATATCTGATAATTAGTTATCCAGGGTTTGCCTCTTTAAACCTG[CGT/TGT,C]
ACAGATACATATGGCTCCTTACGATTTTCCTCACCGTGGCAACTTTATGACTTAAGCATGACTATAATCATGCTATCGGTGATAACGTCTAACTATTCCT

Reverse complement sequence

AGGAATAGTTAGACGTTATCACCGATAGCATGATTATAGTCATGCTTAAGTCATAAAGTTGCCACGGTGAGGAAAATCGTAAGGAGCCATATGTATCTGT[ACG/ACA,G]
CAGGTTTAAAGAGGCAAACCCTGGATAACTAATTATCAGATATGTTTATGACTATATTGTAAAACATTTAGAAATATTACAATAATAAGACTTGTTGATA

Allele Frequencies:

Populations Population SizeFrequency of TGT(primary allele) Frequency of CGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 12.60% 1.52% 0.00% C: 0.04%
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 57.30% 38.20% 4.56% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 24.10% 68.60% 7.30% 0.00% NA
Tropical Japonica  504 97.60% 0.80% 1.59% 0.00% NA
Japonica Intermediate  241 78.40% 19.50% 2.07% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 85.60% 8.90% 3.33% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718640985 CGT -> TGT LOC_Os07g31450.1 upstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> TGT LOC_Os07g31460.1 upstream_gene_variant ; 2035.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> TGT LOC_Os07g31460.2 upstream_gene_variant ; 2035.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> TGT LOC_Os07g31450-LOC_Os07g31460 intergenic_region ; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> C LOC_Os07g31450.1 upstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> C LOC_Os07g31460.1 upstream_gene_variant ; 2034.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> C LOC_Os07g31460.2 upstream_gene_variant ; 2034.0bp to feature; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N
vg0718640985 CGT -> C LOC_Os07g31450-LOC_Os07g31460 intergenic_region ; MODIFIER silent_mutation Average:62.751; most accessible tissue: Callus, score: 81.649 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718640985 1.19E-08 NA Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718640985 NA 2.17E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718640985 NA 1.00E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251