Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718615443:

Variant ID: vg0718615443 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18615443
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTCCTCCAAAATTGCTCTAGTAAGATTCATTCCATAGGAATTTCAAAGTAATTGATAGGAAACAATCCTTTGTTTCAAAGGACTCTATAAGATTATTT[C/T]
CCATAGGATAAAATACTCTAGAATTCCTATGGTTTTTCCTTTGATTCAAAGGGGGCCTAAAGGCTGTGTTCGTTTGAAGGAATTAGGTACCCTTCTTATC

Reverse complement sequence

GATAAGAAGGGTACCTAATTCCTTCAAACGAACACAGCCTTTAGGCCCCCTTTGAATCAAAGGAAAAACCATAGGAATTCTAGAGTATTTTATCCTATGG[G/A]
AAATAATCTTATAGAGTCCTTTGAAACAAAGGATTGTTTCCTATCAATTACTTTGAAATTCCTATGGAATGAATCTTACTAGAGCAATTTTGGAGGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	11.40%	0.02%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	75.30%	24.70%	0.00%	0.00%	NA
Aus	269	53.90%	45.70%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	48.20%	51.80%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718615443	C -> T	LOC_Os07g31430.1	upstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:42.144; most accessible tissue: Callus, score: 57.193	N	N	N	N
vg0718615443	C -> T	LOC_Os07g31420.1	downstream_gene_variant ; 742.0bp to feature; MODIFIER	silent_mutation	Average:42.144; most accessible tissue: Callus, score: 57.193	N	N	N	N
vg0718615443	C -> T	LOC_Os07g31420.2	downstream_gene_variant ; 742.0bp to feature; MODIFIER	silent_mutation	Average:42.144; most accessible tissue: Callus, score: 57.193	N	N	N	N
vg0718615443	C -> T	LOC_Os07g31420-LOC_Os07g31430	intergenic_region ; MODIFIER	silent_mutation	Average:42.144; most accessible tissue: Callus, score: 57.193	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718615443	NA	8.69E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718615443	NA	2.68E-09	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	2.17E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	1.09E-21	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	2.65E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	3.94E-10	7.37E-22	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	8.25E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	1.14E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	6.61E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	2.26E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	8.85E-07	6.18E-23	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	2.01E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	1.35E-10	1.85E-20	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	8.24E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718615443	NA	3.25E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251