\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718582884:

Variant ID: vg0718582884 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18582884
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGTCTCGTCGTATGGGCGTTGTTTGGCTCCGAGATTGGTGCCTGACTGCCTGCCGGTTATTACCACCGCCCGCCCCGCCAAGCAGAGAAGGAGGCCCC[T/C]
TTTTTTTTTAATCGGAGCGAAGCCTGCTTCGTTTGGCGTTTGGAGTTTGGACGTGGGTGGGCTGGAGGGAGCGCAAAATGTTCCAGCTGTTTCGCTTTCA

Reverse complement sequence

TGAAAGCGAAACAGCTGGAACATTTTGCGCTCCCTCCAGCCCACCCACGTCCAAACTCCAAACGCCAAACGAAGCAGGCTTCGCTCCGATTAAAAAAAAA[A/G]
GGGGCCTCCTTCTCTGCTTGGCGGGGCGGGCGGTGGTAATAACCGGCAGGCAGTCAGGCACCAATCTCGGAGCCAAACAACGCCCATACGACGAGACGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 13.00% 5.27% 1.93% NA
All Indica  2759 75.30% 22.10% 2.57% 0.04% NA
All Japonica  1512 82.70% 0.10% 11.31% 5.82% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 26.70% 69.10% 4.20% 0.00% NA
Indica II  465 86.00% 10.80% 3.01% 0.22% NA
Indica III  913 97.30% 0.70% 2.08% 0.00% NA
Indica Intermediate  786 80.20% 18.20% 1.65% 0.00% NA
Temperate Japonica  767 97.00% 0.10% 2.48% 0.39% NA
Tropical Japonica  504 64.90% 0.00% 20.24% 14.88% NA
Japonica Intermediate  241 74.70% 0.40% 20.75% 4.15% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 88.90% 3.30% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718582884 T -> DEL N N silent_mutation Average:96.983; most accessible tissue: Minghui63 root, score: 98.62 N N N N
vg0718582884 T -> C LOC_Os07g31370.1 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:96.983; most accessible tissue: Minghui63 root, score: 98.62 N N N N
vg0718582884 T -> C LOC_Os07g31380.1 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:96.983; most accessible tissue: Minghui63 root, score: 98.62 N N N N
vg0718582884 T -> C LOC_Os07g31370-LOC_Os07g31380 intergenic_region ; MODIFIER silent_mutation Average:96.983; most accessible tissue: Minghui63 root, score: 98.62 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718582884 T C 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718582884 NA 5.54E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 9.47E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 5.52E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 2.11E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 4.67E-06 NA mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 1.54E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.97E-07 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 5.89E-06 NA mr1183_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.18E-11 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 1.34E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.54E-13 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 1.04E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 4.34E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 1.72E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 6.06E-06 mr1263_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 7.26E-07 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 2.14E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 1.27E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 9.06E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 6.14E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 6.75E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.36E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.15E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 8.44E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 2.33E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 4.32E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718582884 NA 3.42E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251