Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718568267:

Variant ID: vg0718568267 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18568267
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGCTCAATAACCGCGAGCACGGCTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCCAACACAT[A/G]
AGCCTCGTCCCAACACATGAGACACGTCACGGCAAAGCTTTTCGATAACCTCGCATTGGCAGTACCCGCTCCATGAACTTTAGCCCTCATGCACTCTAGG

Reverse complement sequence

CCTAGAGTGCATGAGGGCTAAAGTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCGTGACGTGTCTCATGTGTTGGGACGAGGCT[T/C]
ATGTGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGTGCTCGCGGTTATTGAGCACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.30%	16.70%	44.65%	0.30%	NA
All Indica	2759	15.70%	23.20%	60.82%	0.22%	NA
All Japonica	1512	75.50%	4.40%	19.51%	0.53%	NA
Aus	269	38.70%	23.00%	38.29%	0.00%	NA
Indica I	595	7.90%	16.50%	74.96%	0.67%	NA
Indica II	465	15.50%	23.00%	61.08%	0.43%	NA
Indica III	913	20.20%	28.60%	51.26%	0.00%	NA
Indica Intermediate	786	16.70%	22.30%	61.07%	0.00%	NA
Temperate Japonica	767	96.10%	0.50%	3.39%	0.00%	NA
Tropical Japonica	504	48.00%	10.50%	40.48%	0.99%	NA
Japonica Intermediate	241	67.60%	4.10%	26.97%	1.24%	NA
VI/Aromatic	96	93.80%	2.10%	4.17%	0.00%	NA
Intermediate	90	45.60%	21.10%	33.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718568267	A -> DEL	N	N	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0718568267	A -> G	LOC_Os07g31340.1	downstream_gene_variant ; 3048.0bp to feature; MODIFIER	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0718568267	A -> G	LOC_Os07g31350.1	downstream_gene_variant ; 4481.0bp to feature; MODIFIER	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0718568267	A -> G	LOC_Os07g31340.2	downstream_gene_variant ; 3048.0bp to feature; MODIFIER	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0718568267	A -> G	LOC_Os07g31340.3	downstream_gene_variant ; 3048.0bp to feature; MODIFIER	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0718568267	A -> G	LOC_Os07g31340-LOC_Os07g31350	intergenic_region ; MODIFIER	silent_mutation	Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718568267	NA	6.29E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267	8.25E-06	8.24E-06	mr1264	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267	NA	1.18E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267	2.96E-09	2.96E-09	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251