\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718568267:

Variant ID: vg0718568267 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18568267
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGCTCAATAACCGCGAGCACGGCTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCCAACACAT[A/G]
AGCCTCGTCCCAACACATGAGACACGTCACGGCAAAGCTTTTCGATAACCTCGCATTGGCAGTACCCGCTCCATGAACTTTAGCCCTCATGCACTCTAGG

Reverse complement sequence

CCTAGAGTGCATGAGGGCTAAAGTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCGTGACGTGTCTCATGTGTTGGGACGAGGCT[T/C]
ATGTGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGTGCTCGCGGTTATTGAGCACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 16.70% 44.65% 0.30% NA
All Indica  2759 15.70% 23.20% 60.82% 0.22% NA
All Japonica  1512 75.50% 4.40% 19.51% 0.53% NA
Aus  269 38.70% 23.00% 38.29% 0.00% NA
Indica I  595 7.90% 16.50% 74.96% 0.67% NA
Indica II  465 15.50% 23.00% 61.08% 0.43% NA
Indica III  913 20.20% 28.60% 51.26% 0.00% NA
Indica Intermediate  786 16.70% 22.30% 61.07% 0.00% NA
Temperate Japonica  767 96.10% 0.50% 3.39% 0.00% NA
Tropical Japonica  504 48.00% 10.50% 40.48% 0.99% NA
Japonica Intermediate  241 67.60% 4.10% 26.97% 1.24% NA
VI/Aromatic  96 93.80% 2.10% 4.17% 0.00% NA
Intermediate  90 45.60% 21.10% 33.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718568267 A -> DEL N N silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0718568267 A -> G LOC_Os07g31340.1 downstream_gene_variant ; 3048.0bp to feature; MODIFIER silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0718568267 A -> G LOC_Os07g31350.1 downstream_gene_variant ; 4481.0bp to feature; MODIFIER silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0718568267 A -> G LOC_Os07g31340.2 downstream_gene_variant ; 3048.0bp to feature; MODIFIER silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0718568267 A -> G LOC_Os07g31340.3 downstream_gene_variant ; 3048.0bp to feature; MODIFIER silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0718568267 A -> G LOC_Os07g31340-LOC_Os07g31350 intergenic_region ; MODIFIER silent_mutation Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718568267 NA 6.29E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267 8.25E-06 8.24E-06 mr1264 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267 NA 1.18E-07 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718568267 2.96E-09 2.96E-09 mr1663 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251