\
| Variant ID: vg0718568267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18568267 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )
GGTGCTCAATAACCGCGAGCACGGCTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCCAACACAT[A/G]
AGCCTCGTCCCAACACATGAGACACGTCACGGCAAAGCTTTTCGATAACCTCGCATTGGCAGTACCCGCTCCATGAACTTTAGCCCTCATGCACTCTAGG
CCTAGAGTGCATGAGGGCTAAAGTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCGTGACGTGTCTCATGTGTTGGGACGAGGCT[T/C]
ATGTGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGTGCTCGCGGTTATTGAGCACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 16.70% | 44.65% | 0.30% | NA |
| All Indica | 2759 | 15.70% | 23.20% | 60.82% | 0.22% | NA |
| All Japonica | 1512 | 75.50% | 4.40% | 19.51% | 0.53% | NA |
| Aus | 269 | 38.70% | 23.00% | 38.29% | 0.00% | NA |
| Indica I | 595 | 7.90% | 16.50% | 74.96% | 0.67% | NA |
| Indica II | 465 | 15.50% | 23.00% | 61.08% | 0.43% | NA |
| Indica III | 913 | 20.20% | 28.60% | 51.26% | 0.00% | NA |
| Indica Intermediate | 786 | 16.70% | 22.30% | 61.07% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 0.50% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 10.50% | 40.48% | 0.99% | NA |
| Japonica Intermediate | 241 | 67.60% | 4.10% | 26.97% | 1.24% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 21.10% | 33.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718568267 | A -> DEL | N | N | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0718568267 | A -> G | LOC_Os07g31340.1 | downstream_gene_variant ; 3048.0bp to feature; MODIFIER | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0718568267 | A -> G | LOC_Os07g31350.1 | downstream_gene_variant ; 4481.0bp to feature; MODIFIER | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0718568267 | A -> G | LOC_Os07g31340.2 | downstream_gene_variant ; 3048.0bp to feature; MODIFIER | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0718568267 | A -> G | LOC_Os07g31340.3 | downstream_gene_variant ; 3048.0bp to feature; MODIFIER | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0718568267 | A -> G | LOC_Os07g31340-LOC_Os07g31350 | intergenic_region ; MODIFIER | silent_mutation | Average:19.467; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718568267 | NA | 6.29E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718568267 | 8.25E-06 | 8.24E-06 | mr1264 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718568267 | NA | 1.18E-07 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718568267 | 2.96E-09 | 2.96E-09 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |