Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718524827:

Variant ID: vg0718524827 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18524827
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATATATGGACACACATTTGAACTATTAAACATAGTCTAATAACAAAACAAATTACAAATTTCGCCTGTAAACTGCGAGACAAATTTATTAAGCTTAAT[C/T]
AATCCGTCATTAGCAAATATTTATTGTAGCACCACATTATCAAATCATAGAGCAATTAGGCTTAATAAATCCATCTCGCAATTTACACGCAATCTGTGTA

Reverse complement sequence

TACACAGATTGCGTGTAAATTGCGAGATGGATTTATTAAGCCTAATTGCTCTATGATTTGATAATGTGGTGCTACAATAAATATTTGCTAATGACGGATT[G/A]
ATTAAGCTTAATAAATTTGTCTCGCAGTTTACAGGCGAAATTTGTAATTTGTTTTGTTATTAGACTATGTTTAATAGTTCAAATGTGTGTCCATATATCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	28.10%	0.02%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.00%	0.00%	NA
All Japonica	1512	24.90%	75.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	4.20%	95.80%	0.00%	0.00%	NA
Tropical Japonica	504	52.40%	47.60%	0.00%	0.00%	NA
Japonica Intermediate	241	33.60%	66.40%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718524827	C -> T	LOC_Os07g31290.1	upstream_gene_variant ; 3681.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0718524827	C -> T	LOC_Os07g31280.1	downstream_gene_variant ; 1208.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0718524827	C -> T	LOC_Os07g31280.2	downstream_gene_variant ; 1208.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0718524827	C -> T	LOC_Os07g31280.3	downstream_gene_variant ; 1208.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0718524827	C -> T	LOC_Os07g31280-LOC_Os07g31290	intergenic_region ; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718524827	NA	4.39E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	8.64E-06	1.45E-33	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	9.09E-10	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	7.99E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	1.38E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	4.07E-06	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	8.97E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	3.22E-06	NA	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	8.94E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	7.92E-54	mr1563	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	4.70E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	4.36E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	5.36E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	9.76E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	7.37E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	3.02E-07	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	5.47E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	6.34E-07	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	1.62E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	1.26E-80	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718524827	NA	5.90E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251