\
| Variant ID: vg0718397736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18397736 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTACCATCAAAACTAAAGAGTAATTAACTCATCCACTACGTAACAAAACCATTAAATTATACACAAACAAATAAGTAATAAGATGGTTTCTCGGATTC[T/C]
GGTCAACAATTTAATTTAGGGACTATCTATACAACATTCAACTGAAAATTAGCCTAAAAATCTATCAAATGTAACTGTAACATAATTACAATGTAATTTT
AAAATTACATTGTAATTATGTTACAGTTACATTTGATAGATTTTTAGGCTAATTTTCAGTTGAATGTTGTATAGATAGTCCCTAAATTAAATTGTTGACC[A/G]
GAATCCGAGAAACCATCTTATTACTTATTTGTTTGTGTATAATTTAATGGTTTTGTTACGTAGTGGATGAGTTAATTACTCTTTAGTTTTGATGGTAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 68.40% | 31.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 48.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718397736 | T -> C | LOC_Os07g31080.1 | upstream_gene_variant ; 4855.0bp to feature; MODIFIER | silent_mutation | Average:40.158; most accessible tissue: Callus, score: 68.994 | N | N | N | N |
| vg0718397736 | T -> C | LOC_Os07g31070.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.158; most accessible tissue: Callus, score: 68.994 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718397736 | 5.48E-06 | 2.59E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 2.93E-06 | NA | mr1276_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 1.77E-07 | NA | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 1.57E-09 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 6.01E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 3.72E-07 | NA | mr1645_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 1.46E-06 | NA | mr1647_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 5.52E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 2.28E-06 | NA | mr1663_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 4.41E-06 | NA | mr1665_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 1.48E-06 | mr1682_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 2.42E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 1.60E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | NA | 1.12E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 3.63E-06 | 3.63E-06 | mr1754_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 7.52E-06 | NA | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 6.34E-06 | NA | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 4.86E-07 | NA | mr1833_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 4.84E-06 | NA | mr1833_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718397736 | 8.59E-06 | NA | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |