\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718355901:

Variant ID: vg0718355901 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18355901
Reference Allele: CAlternative Allele: G,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGCGCCCGTTTTGCACAGGCTACCATGCAATCAGTGGGACCCACATGGCCTAAGCGCAGCATGCATATGGCCCGGTATGCTTGATGGGCCAGGCAAAA[C/G,A]
CAATTTCATTGGTTGGCCAAGCCTGGATTGTTGAGCCTTGTAGAGACTATTATTGTATACATCAACTGTAAAACAAGTTCTAAATGAGTTGGATAAGAAT

Reverse complement sequence

ATTCTTATCCAACTCATTTAGAACTTGTTTTACAGTTGATGTATACAATAATAGTCTCTACAAGGCTCAACAATCCAGGCTTGGCCAACCAATGAAATTG[G/C,T]
TTTTGCCTGGCCCATCAAGCATACCGGGCCATATGCATGCTGCGCTTAGGCCATGTGGGTCCCACTGATTGCATGGTAGCCTGTGCAAAACGGGCGCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 21.50% 2.12% 26.85% A: 0.21%
All Indica  2759 59.10% 2.00% 1.92% 36.68% A: 0.36%
All Japonica  1512 42.10% 56.60% 0.93% 0.33% NA
Aus  269 2.60% 2.60% 10.41% 84.39% NA
Indica I  595 20.20% 2.00% 3.87% 72.27% A: 1.68%
Indica II  465 80.40% 2.80% 0.65% 16.13% NA
Indica III  913 64.00% 0.70% 1.20% 34.17% NA
Indica Intermediate  786 70.20% 2.90% 2.04% 24.81% NA
Temperate Japonica  767 19.80% 79.10% 1.04% 0.00% NA
Tropical Japonica  504 76.00% 22.60% 0.99% 0.40% NA
Japonica Intermediate  241 42.30% 56.00% 0.41% 1.24% NA
VI/Aromatic  96 6.20% 79.20% 1.04% 13.54% NA
Intermediate  90 55.60% 26.70% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718355901 C -> DEL N N silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> G LOC_Os07g30980.1 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> G LOC_Os07g31000.1 upstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> G LOC_Os07g30990.1 downstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> G LOC_Os07g31010.1 downstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> G LOC_Os07g30990-LOC_Os07g31000 intergenic_region ; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> A LOC_Os07g30980.1 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> A LOC_Os07g31000.1 upstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> A LOC_Os07g30990.1 downstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> A LOC_Os07g31010.1 downstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N
vg0718355901 C -> A LOC_Os07g30990-LOC_Os07g31000 intergenic_region ; MODIFIER silent_mutation Average:67.693; most accessible tissue: Minghui63 root, score: 96.57 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718355901 C A 0.0 -0.03 -0.01 0.0 0.0 0.0
vg0718355901 C G 0.28 0.25 0.17 0.18 0.2 0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718355901 NA 3.38E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 3.25E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 1.29E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 2.14E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 1.30E-06 1.14E-09 mr1980 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 3.02E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 4.01E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 2.01E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 1.58E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 1.07E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 6.84E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718355901 NA 2.23E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251