\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718328688:

Variant ID: vg0718328688 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 18328688
Reference Allele: CAlternative Allele: T,CTAG
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTATTAATTTAATTTTATTTGATAAAAATAGTGTTATTGGATTGTCATTTAAATTTATTTTCCTATAATTATGATTTTATTTCTACAAACATTATAG[C/T,CTAG]
ATATGAGAAATTTAAAATCAAATATTAGTTTTGAAGACTTTATCAAGTTTGACCGTACCTTAGTGAGTGAGACAGTGAGACAGAGGGAGTACCAACTAAA

Reverse complement sequence

TTTAGTTGGTACTCCCTCTGTCTCACTGTCTCACTCACTAAGGTACGGTCAAACTTGATAAAGTCTTCAAAACTAATATTTGATTTTAAATTTCTCATAT[G/A,CTAG]
CTATAATGTTTGTAGAAATAAAATCATAATTATAGGAAAATAAATTTAAATGACAATCCAATAACACTATTTTTATCAAATAAAATTAAATTAATAATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 22.80% 0.11% 0.00% CTAG: 3.66%
All Indica  2759 97.00% 2.20% 0.00% 0.00% CTAG: 0.76%
All Japonica  1512 40.10% 59.50% 0.33% 0.00% CTAG: 0.07%
Aus  269 43.10% 2.20% 0.00% 0.00% CTAG: 54.65%
Indica I  595 98.00% 1.50% 0.00% 0.00% CTAG: 0.50%
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.30% 0.00% 0.00% CTAG: 0.55%
Indica Intermediate  786 93.80% 4.60% 0.00% 0.00% CTAG: 1.65%
Temperate Japonica  767 16.30% 83.40% 0.26% 0.00% NA
Tropical Japonica  504 75.20% 24.60% 0.20% 0.00% NA
Japonica Intermediate  241 42.30% 56.40% 0.83% 0.00% CTAG: 0.41%
VI/Aromatic  96 9.40% 88.50% 0.00% 0.00% CTAG: 2.08%
Intermediate  90 70.00% 27.80% 0.00% 0.00% CTAG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718328688 C -> CTAG LOC_Os07g30950.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> CTAG LOC_Os07g30940.1 downstream_gene_variant ; 3996.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> CTAG LOC_Os07g30960.1 downstream_gene_variant ; 3066.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> CTAG LOC_Os07g30940-LOC_Os07g30950 intergenic_region ; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> T LOC_Os07g30950.1 upstream_gene_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> T LOC_Os07g30940.1 downstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> T LOC_Os07g30960.1 downstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N
vg0718328688 C -> T LOC_Os07g30940-LOC_Os07g30950 intergenic_region ; MODIFIER silent_mutation Average:69.632; most accessible tissue: Callus, score: 80.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718328688 NA 9.61E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 8.08E-09 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 4.04E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 2.07E-06 1.42E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 1.36E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 8.69E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 3.09E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 4.19E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 5.42E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 2.50E-06 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 2.06E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 3.07E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 2.16E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 2.31E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718328688 NA 1.28E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251