| Variant ID: vg0718328688 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 18328688 |
| Reference Allele: C | Alternative Allele: T,CTAG |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATATTATTAATTTAATTTTATTTGATAAAAATAGTGTTATTGGATTGTCATTTAAATTTATTTTCCTATAATTATGATTTTATTTCTACAAACATTATAG[C/T,CTAG]
ATATGAGAAATTTAAAATCAAATATTAGTTTTGAAGACTTTATCAAGTTTGACCGTACCTTAGTGAGTGAGACAGTGAGACAGAGGGAGTACCAACTAAA
TTTAGTTGGTACTCCCTCTGTCTCACTGTCTCACTCACTAAGGTACGGTCAAACTTGATAAAGTCTTCAAAACTAATATTTGATTTTAAATTTCTCATAT[G/A,CTAG]
CTATAATGTTTGTAGAAATAAAATCATAATTATAGGAAAATAAATTTAAATGACAATCCAATAACACTATTTTTATCAAATAAAATTAAATTAATAATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 22.80% | 0.11% | 0.00% | CTAG: 3.66% |
| All Indica | 2759 | 97.00% | 2.20% | 0.00% | 0.00% | CTAG: 0.76% |
| All Japonica | 1512 | 40.10% | 59.50% | 0.33% | 0.00% | CTAG: 0.07% |
| Aus | 269 | 43.10% | 2.20% | 0.00% | 0.00% | CTAG: 54.65% |
| Indica I | 595 | 98.00% | 1.50% | 0.00% | 0.00% | CTAG: 0.50% |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.30% | 0.00% | 0.00% | CTAG: 0.55% |
| Indica Intermediate | 786 | 93.80% | 4.60% | 0.00% | 0.00% | CTAG: 1.65% |
| Temperate Japonica | 767 | 16.30% | 83.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 75.20% | 24.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.30% | 56.40% | 0.83% | 0.00% | CTAG: 0.41% |
| VI/Aromatic | 96 | 9.40% | 88.50% | 0.00% | 0.00% | CTAG: 2.08% |
| Intermediate | 90 | 70.00% | 27.80% | 0.00% | 0.00% | CTAG: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718328688 | C -> CTAG | LOC_Os07g30950.1 | upstream_gene_variant ; 267.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> CTAG | LOC_Os07g30940.1 | downstream_gene_variant ; 3996.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> CTAG | LOC_Os07g30960.1 | downstream_gene_variant ; 3066.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> CTAG | LOC_Os07g30940-LOC_Os07g30950 | intergenic_region ; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> T | LOC_Os07g30950.1 | upstream_gene_variant ; 268.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> T | LOC_Os07g30940.1 | downstream_gene_variant ; 3995.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> T | LOC_Os07g30960.1 | downstream_gene_variant ; 3067.0bp to feature; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0718328688 | C -> T | LOC_Os07g30940-LOC_Os07g30950 | intergenic_region ; MODIFIER | silent_mutation | Average:69.632; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718328688 | NA | 9.61E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 8.08E-09 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 4.04E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | 2.07E-06 | 1.42E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 1.36E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 8.69E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 3.09E-08 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 4.19E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 5.42E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | 2.50E-06 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 2.06E-12 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | 3.07E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | 2.16E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 2.31E-07 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718328688 | NA | 1.28E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |