\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718149327:

Variant ID: vg0718149327 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18149327
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCCTCGCGCCACACTGCGCCGTGGCCACGGCCACCACCACCAGCAGCTGCAGCGTCAGGAAACAGAGCTGCAGCTGCTGCGGCGCCGCCCATCTGCC[A/G]
CGGCGGCTGCAGCACAAACAGCAGAGGAGGTGCGGGATTCGTGTCCGCGCCGTCGAGACGGACGCCGCCGCCGGCGGCGAGGCGAAGGCCGCACCGGAGG

Reverse complement sequence

CCTCCGGTGCGGCCTTCGCCTCGCCGCCGGCGGCGGCGTCCGTCTCGACGGCGCGGACACGAATCCCGCACCTCCTCTGCTGTTTGTGCTGCAGCCGCCG[T/C]
GGCAGATGGGCGGCGCCGCAGCAGCTGCAGCTCTGTTTCCTGACGCTGCAGCTGCTGGTGGTGGTGGCCGTGGCCACGGCGCAGTGTGGCGCGAGGCGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.00% 0.15% 0.34% NA
All Indica  2759 34.90% 64.40% 0.14% 0.51% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.07% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 25.20% 73.80% 0.34% 0.67% NA
Indica II  465 15.50% 83.70% 0.22% 0.65% NA
Indica III  913 41.40% 58.30% 0.00% 0.33% NA
Indica Intermediate  786 46.30% 53.10% 0.13% 0.51% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718149327 A -> DEL LOC_Os07g30670.1 N frameshift_variant Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0718149327 A -> DEL LOC_Os07g30670.2 N frameshift_variant Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0718149327 A -> DEL LOC_Os07g30670.3 N frameshift_variant Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0718149327 A -> G LOC_Os07g30670.1 synonymous_variant ; p.Pro52Pro; LOW synonymous_codon Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0718149327 A -> G LOC_Os07g30670.2 synonymous_variant ; p.Pro52Pro; LOW synonymous_codon Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg0718149327 A -> G LOC_Os07g30670.3 synonymous_variant ; p.Pro52Pro; LOW synonymous_codon Average:85.572; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718149327 A G 0.02 0.01 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718149327 NA 3.54E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.09E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.96E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.93E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 3.40E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 2.70E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 9.90E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.78E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 4.39E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 4.51E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.17E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 2.63E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 4.41E-07 8.75E-09 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.79E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 1.50E-18 mr1579_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 3.52E-07 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 9.78E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 5.65E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718149327 NA 6.06E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251