\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718147951:

Variant ID: vg0718147951 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18147951
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.35, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAACAGTATCGGTACAGTTGGGAAATTTTCGTACCGTTTTCGCTCCTAATCTATTATGTATATGGTATGTTTTGATTCATTGTATTAAAAGGGGTTCCAC[T/C]
CAGATTAAGTTTTTTTTTTGGGACAGATGGAGTGGCCTCCAAGCAAGTTACTTATTGGGCTCTTCCAAGTGAAGGCAGCACAGGAGAAAAAACATATCTT

Reverse complement sequence

AAGATATGTTTTTTCTCCTGTGCTGCCTTCACTTGGAAGAGCCCAATAAGTAACTTGCTTGGAGGCCACTCCATCTGTCCCAAAAAAAAAACTTAATCTG[A/G]
GTGGAACCCCTTTTAATACAATGAATCAAAACATACCATATACATAATAGATTAGGAGCGAAAACGGTACGAAAATTTCCCAACTGTACCGATACTGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.60% 0.32% 0.19% NA
All Indica  2759 47.00% 52.30% 0.43% 0.29% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.07% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 26.10% 72.80% 1.01% 0.17% NA
Indica II  465 77.60% 21.10% 0.86% 0.43% NA
Indica III  913 39.00% 60.70% 0.00% 0.33% NA
Indica Intermediate  786 54.10% 45.40% 0.25% 0.25% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718147951 T -> DEL N N silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0718147951 T -> C LOC_Os07g30660.1 upstream_gene_variant ; 4283.0bp to feature; MODIFIER silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0718147951 T -> C LOC_Os07g30670.1 upstream_gene_variant ; 1130.0bp to feature; MODIFIER silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0718147951 T -> C LOC_Os07g30670.2 upstream_gene_variant ; 1134.0bp to feature; MODIFIER silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0718147951 T -> C LOC_Os07g30670.3 upstream_gene_variant ; 1134.0bp to feature; MODIFIER silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0718147951 T -> C LOC_Os07g30660-LOC_Os07g30670 intergenic_region ; MODIFIER silent_mutation Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718147951 NA 2.94E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 1.44E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 1.75E-06 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 4.34E-07 6.42E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 1.43E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 4.61E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 2.25E-06 1.53E-07 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 7.82E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 1.56E-06 mr1711_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 5.04E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718147951 NA 3.15E-08 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251