\
| Variant ID: vg0718147951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18147951 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.35, others allele: 0.00, population size: 107. )
AAACAGTATCGGTACAGTTGGGAAATTTTCGTACCGTTTTCGCTCCTAATCTATTATGTATATGGTATGTTTTGATTCATTGTATTAAAAGGGGTTCCAC[T/C]
CAGATTAAGTTTTTTTTTTGGGACAGATGGAGTGGCCTCCAAGCAAGTTACTTATTGGGCTCTTCCAAGTGAAGGCAGCACAGGAGAAAAAACATATCTT
AAGATATGTTTTTTCTCCTGTGCTGCCTTCACTTGGAAGAGCCCAATAAGTAACTTGCTTGGAGGCCACTCCATCTGTCCCAAAAAAAAAACTTAATCTG[A/G]
GTGGAACCCCTTTTAATACAATGAATCAAAACATACCATATACATAATAGATTAGGAGCGAAAACGGTACGAAAATTTCCCAACTGTACCGATACTGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 32.60% | 0.32% | 0.19% | NA |
| All Indica | 2759 | 47.00% | 52.30% | 0.43% | 0.29% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 69.50% | 30.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.10% | 72.80% | 1.01% | 0.17% | NA |
| Indica II | 465 | 77.60% | 21.10% | 0.86% | 0.43% | NA |
| Indica III | 913 | 39.00% | 60.70% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 54.10% | 45.40% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718147951 | T -> DEL | N | N | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0718147951 | T -> C | LOC_Os07g30660.1 | upstream_gene_variant ; 4283.0bp to feature; MODIFIER | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0718147951 | T -> C | LOC_Os07g30670.1 | upstream_gene_variant ; 1130.0bp to feature; MODIFIER | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0718147951 | T -> C | LOC_Os07g30670.2 | upstream_gene_variant ; 1134.0bp to feature; MODIFIER | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0718147951 | T -> C | LOC_Os07g30670.3 | upstream_gene_variant ; 1134.0bp to feature; MODIFIER | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0718147951 | T -> C | LOC_Os07g30660-LOC_Os07g30670 | intergenic_region ; MODIFIER | silent_mutation | Average:65.661; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718147951 | NA | 2.94E-08 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 1.44E-13 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 1.75E-06 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | 4.34E-07 | 6.42E-08 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 1.43E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 4.61E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | 2.25E-06 | 1.53E-07 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 7.82E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 1.56E-06 | mr1711_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 5.04E-10 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718147951 | NA | 3.15E-08 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |