\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718144292:

Variant ID: vg0718144292 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18144292
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAATTAGGATATTTTATGTAATTTCCTTAGAGATATGTTTGGGCAAAAGTCTGCCGCAAAGACTTATAGTATCTTAGAGTTTGTTAGAGATAAGAGT[C/T]
GTGTCCAATATGGACATATCTTGTATTTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATAAAAAACACACACGTTCAATACAATTTCGGCGCATCGC

Reverse complement sequence

GCGATGCGCCGAAATTGTATTGAACGTGTGTGTTTTTTATTACATAGGGCTCGGGGTCTATTTATACCCGAGAAATACAAGATATGTCCATATTGGACAC[G/A]
ACTCTTATCTCTAACAAACTCTAAGATACTATAAGTCTTTGCGGCAGACTTTTGCCCAAACATATCTCTAAGGAAATTACATAAAATATCCTAATTAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 5.40% 0.02% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 83.70% 16.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 71.30% 28.60% 0.13% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718144292 C -> T LOC_Os07g30660.1 upstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0718144292 C -> T LOC_Os07g30670.1 upstream_gene_variant ; 4789.0bp to feature; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0718144292 C -> T LOC_Os07g30670.2 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0718144292 C -> T LOC_Os07g30670.3 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0718144292 C -> T LOC_Os07g30650.1 downstream_gene_variant ; 4168.0bp to feature; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0718144292 C -> T LOC_Os07g30660-LOC_Os07g30670 intergenic_region ; MODIFIER silent_mutation Average:27.798; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718144292 NA 2.80E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144292 7.24E-07 3.64E-08 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251