Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718144114:

Variant ID: vg0718144114 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18144114
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAAGAATCGGCTGGAGTCCGGATCGGCTACGACTGGGATCGGCTAAGTCTGAGTTGGACTGGTTAAGTGATACAGCCGATTCTGACAATACGACCCGT[A/G]
TGCGACATTGGGTTCGAGTTGATATGCTTCAAGATGATTGCCACGCATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTA

Reverse complement sequence

TACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGCGTGGCAATCATCTTGAAGCATATCAACTCGAACCCAATGTCGCA[T/C]
ACGGGTCGTATTGTCAGAATCGGCTGTATCACTTAACCAGTCCAACTCAGACTTAGCCGATCCCAGTCGTAGCCGATCCGGACTCCAGCCGATTCTTACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	49.70%	0.23%	0.00%	NA
All Indica	2759	46.50%	53.10%	0.33%	0.00%	NA
All Japonica	1512	61.80%	38.10%	0.13%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	26.40%	73.10%	0.50%	0.00%	NA
Indica II	465	78.30%	21.30%	0.43%	0.00%	NA
Indica III	913	38.80%	61.20%	0.00%	0.00%	NA
Indica Intermediate	786	52.00%	47.50%	0.51%	0.00%	NA
Temperate Japonica	767	68.40%	31.40%	0.13%	0.00%	NA
Tropical Japonica	504	48.40%	51.40%	0.20%	0.00%	NA
Japonica Intermediate	241	68.50%	31.50%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718144114	A -> G	LOC_Os07g30660.1	upstream_gene_variant ; 446.0bp to feature; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg0718144114	A -> G	LOC_Os07g30670.1	upstream_gene_variant ; 4967.0bp to feature; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg0718144114	A -> G	LOC_Os07g30670.2	upstream_gene_variant ; 4971.0bp to feature; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg0718144114	A -> G	LOC_Os07g30670.3	upstream_gene_variant ; 4971.0bp to feature; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg0718144114	A -> G	LOC_Os07g30650.1	downstream_gene_variant ; 3990.0bp to feature; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg0718144114	A -> G	LOC_Os07g30660-LOC_Os07g30670	intergenic_region ; MODIFIER	silent_mutation	Average:31.765; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718144114	6.94E-07	1.28E-07	mr1480	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144114	2.68E-08	5.98E-09	mr1692	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144114	NA	1.60E-07	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144114	6.29E-07	5.54E-08	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144114	NA	1.94E-06	mr1711_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144114	NA	3.03E-08	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251