Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718133718:

Variant ID: vg0718133718 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18133718
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GCAATAATGTTGGAAAAATACGCGTCAAAATAGTTAACAAATATTCAACGGGATTAGCTATATATTTATCGTTAAATTTTAACTAAAAAATTTGACAAAT[A/G]
TAAATATAGTACAATCATGATATTATTATATTGTAATTTGCATGTAATTATAGTGAAACATCTATGTAACTTTCAAAAATCCTTAAGTGACATGCTAATT

Reverse complement sequence

AATTAGCATGTCACTTAAGGATTTTTGAAAGTTACATAGATGTTTCACTATAATTACATGCAAATTACAATATAATAATATCATGATTGTACTATATTTA[T/C]
ATTTGTCAAATTTTTTAGTTAAAATTTAACGATAAATATATAGCTAATCCCGTTGAATATTTGTTAACTATTTTGACGCGTATTTTTCCAACATTATTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.20%	0.40%	0.00%	NA
All Indica	2759	71.70%	27.80%	0.43%	0.00%	NA
All Japonica	1512	16.70%	83.10%	0.20%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	75.80%	23.40%	0.84%	0.00%	NA
Indica II	465	84.30%	15.10%	0.65%	0.00%	NA
Indica III	913	68.30%	31.30%	0.33%	0.00%	NA
Indica Intermediate	786	65.10%	34.70%	0.13%	0.00%	NA
Temperate Japonica	767	28.80%	71.10%	0.13%	0.00%	NA
Tropical Japonica	504	4.00%	95.60%	0.40%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	91.70%	1.04%	0.00%	NA
Intermediate	90	33.30%	63.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718133718	A -> G	LOC_Os07g30650.1	upstream_gene_variant ; 3040.0bp to feature; MODIFIER	silent_mutation	Average:42.115; most accessible tissue: Callus, score: 80.389	N	N	N	N
vg0718133718	A -> G	LOC_Os07g30630.1	downstream_gene_variant ; 4099.0bp to feature; MODIFIER	silent_mutation	Average:42.115; most accessible tissue: Callus, score: 80.389	N	N	N	N
vg0718133718	A -> G	LOC_Os07g30640.1	intron_variant ; MODIFIER	silent_mutation	Average:42.115; most accessible tissue: Callus, score: 80.389	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718133718	NA	3.62E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	3.65E-06	1.46E-07	mr1480	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	NA	6.38E-08	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	NA	9.16E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	NA	9.87E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	NA	5.46E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718133718	2.03E-07	1.98E-10	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251