\
| Variant ID: vg0718133718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18133718 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 100. )
GCAATAATGTTGGAAAAATACGCGTCAAAATAGTTAACAAATATTCAACGGGATTAGCTATATATTTATCGTTAAATTTTAACTAAAAAATTTGACAAAT[A/G]
TAAATATAGTACAATCATGATATTATTATATTGTAATTTGCATGTAATTATAGTGAAACATCTATGTAACTTTCAAAAATCCTTAAGTGACATGCTAATT
AATTAGCATGTCACTTAAGGATTTTTGAAAGTTACATAGATGTTTCACTATAATTACATGCAAATTACAATATAATAATATCATGATTGTACTATATTTA[T/C]
ATTTGTCAAATTTTTTAGTTAAAATTTAACGATAAATATATAGCTAATCCCGTTGAATATTTGTTAACTATTTTGACGCGTATTTTTCCAACATTATTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 71.70% | 27.80% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 16.70% | 83.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 23.40% | 0.84% | 0.00% | NA |
| Indica II | 465 | 84.30% | 15.10% | 0.65% | 0.00% | NA |
| Indica III | 913 | 68.30% | 31.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 65.10% | 34.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 28.80% | 71.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 95.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 91.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 63.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718133718 | A -> G | LOC_Os07g30650.1 | upstream_gene_variant ; 3040.0bp to feature; MODIFIER | silent_mutation | Average:42.115; most accessible tissue: Callus, score: 80.389 | N | N | N | N |
| vg0718133718 | A -> G | LOC_Os07g30630.1 | downstream_gene_variant ; 4099.0bp to feature; MODIFIER | silent_mutation | Average:42.115; most accessible tissue: Callus, score: 80.389 | N | N | N | N |
| vg0718133718 | A -> G | LOC_Os07g30640.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.115; most accessible tissue: Callus, score: 80.389 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718133718 | NA | 3.62E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | 3.65E-06 | 1.46E-07 | mr1480 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | NA | 6.38E-08 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | NA | 9.16E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | NA | 9.87E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | NA | 5.46E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718133718 | 2.03E-07 | 1.98E-10 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |